Incidental Mutation 'R7218:Baiap2l1'
ID561584
Institutional Source Beutler Lab
Gene Symbol Baiap2l1
Ensembl Gene ENSMUSG00000038859
Gene NameBAI1-associated protein 2-like 1
SynonymsIRTKS, 1300006M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location144264526-144358112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144275877 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 443 (S443P)
Ref Sequence ENSEMBL: ENSMUSP00000053129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]
PDB Structure
Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055190
AA Change: S443P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: S443P

DomainStartEndE-ValueType
Pfam:IMD 16 236 4.4e-65 PFAM
SH3 343 402 1.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155491
SMART Domains Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

DomainStartEndE-ValueType
Pfam:DUF2367 27 90 1.1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Baiap2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Baiap2l1 APN 5 144285546 nonsense probably null
IGL00789:Baiap2l1 APN 5 144286069 splice site probably null
IGL00922:Baiap2l1 APN 5 144318967 missense probably damaging 1.00
IGL01446:Baiap2l1 APN 5 144275913 missense probably benign 0.10
IGL01603:Baiap2l1 APN 5 144280815 intron probably benign
IGL02748:Baiap2l1 APN 5 144266605 intron probably benign
IGL03348:Baiap2l1 APN 5 144278531 missense probably benign 0.08
PIT4382001:Baiap2l1 UTSW 5 144278670 missense possibly damaging 0.71
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0110:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0197:Baiap2l1 UTSW 5 144266010 missense probably damaging 0.96
R0469:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0744:Baiap2l1 UTSW 5 144266641 missense probably benign 0.21
R0755:Baiap2l1 UTSW 5 144284557 missense probably damaging 0.97
R0765:Baiap2l1 UTSW 5 144277703 missense probably damaging 0.99
R1051:Baiap2l1 UTSW 5 144286133 missense probably damaging 1.00
R1809:Baiap2l1 UTSW 5 144324555 critical splice donor site probably null
R3889:Baiap2l1 UTSW 5 144278535 missense possibly damaging 0.67
R4451:Baiap2l1 UTSW 5 144278552 missense probably damaging 1.00
R5093:Baiap2l1 UTSW 5 144278553 missense probably damaging 1.00
R5471:Baiap2l1 UTSW 5 144282141 missense probably benign 0.01
R5523:Baiap2l1 UTSW 5 144275958 missense probably damaging 1.00
R5524:Baiap2l1 UTSW 5 144280949 missense probably benign 0.01
R5586:Baiap2l1 UTSW 5 144282139 missense probably damaging 0.99
R5603:Baiap2l1 UTSW 5 144265977 missense probably damaging 1.00
R5735:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6353:Baiap2l1 UTSW 5 144282088 missense possibly damaging 0.80
R6572:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6619:Baiap2l1 UTSW 5 144286106 missense probably benign 0.22
R6981:Baiap2l1 UTSW 5 144285579 missense possibly damaging 0.94
R7352:Baiap2l1 UTSW 5 144324626 missense probably benign 0.03
X0022:Baiap2l1 UTSW 5 144278652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGAGACAGAGTAACATGC -3'
(R):5'- TGTAGCGCAGTACTGTCACC -3'

Sequencing Primer
(F):5'- TAACATGCAGGGAGGGCTTAG -3'
(R):5'- GTATGTCTGTGAACCACATGCAC -3'
Posted On2019-06-26