Incidental Mutation 'R7218:Il4ra'
ID561598
Institutional Source Beutler Lab
Gene Symbol Il4ra
Ensembl Gene ENSMUSG00000030748
Gene Nameinterleukin 4 receptor, alpha
SynonymsIl4r, IL-4 receptor alpha chain, CD124
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7218 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location125552120-125579474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125575778 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 386 (D386G)
Ref Sequence ENSEMBL: ENSMUSP00000033004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033004] [ENSMUST00000206846]
Predicted Effect probably benign
Transcript: ENSMUST00000033004
AA Change: D386G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033004
Gene: ENSMUSG00000030748
AA Change: D386G

DomainStartEndE-ValueType
Pfam:IL4Ra_N 28 122 9.9e-39 PFAM
FN3 124 211 3.14e0 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206846
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Nullizygous mice exhibit reduced T helper 2 cell response to N. brasiliensis infection. Homozygotes for a null allele also display severe susceptibility to S. mansoni infection, enhanced carcinogen-induced intestinal tumour initiation, and altered control of chronic Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Il4ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Il4ra APN 7 125569175 critical splice donor site probably null
IGL01067:Il4ra APN 7 125575161 missense probably benign 0.09
IGL01107:Il4ra APN 7 125575914 missense possibly damaging 0.88
IGL02224:Il4ra APN 7 125570099 splice site probably benign
IGL02249:Il4ra APN 7 125567224 missense probably benign 0.01
IGL02383:Il4ra APN 7 125571504 missense probably benign 0.06
IGL02614:Il4ra APN 7 125575790 nonsense probably null
IGL02879:Il4ra APN 7 125576897 missense possibly damaging 0.88
Haile UTSW 7 125574717 critical splice donor site probably null
Lowe UTSW 7 125567221 missense probably damaging 1.00
IGL02991:Il4ra UTSW 7 125575661 missense possibly damaging 0.70
PIT4418001:Il4ra UTSW 7 125576338 missense probably benign 0.01
R0066:Il4ra UTSW 7 125576231 missense possibly damaging 0.80
R0127:Il4ra UTSW 7 125569070 missense probably damaging 1.00
R0148:Il4ra UTSW 7 125575537 missense probably damaging 1.00
R0238:Il4ra UTSW 7 125575199 splice site probably benign
R0239:Il4ra UTSW 7 125575199 splice site probably benign
R0884:Il4ra UTSW 7 125574663 missense probably damaging 1.00
R1102:Il4ra UTSW 7 125574717 critical splice donor site probably null
R1622:Il4ra UTSW 7 125570053 missense possibly damaging 0.87
R1773:Il4ra UTSW 7 125567182 missense possibly damaging 0.94
R4510:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4511:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4612:Il4ra UTSW 7 125576083 missense probably benign 0.14
R5865:Il4ra UTSW 7 125575176 missense probably benign 0.00
R5996:Il4ra UTSW 7 125567221 missense probably damaging 1.00
R6057:Il4ra UTSW 7 125571563 missense probably damaging 1.00
R6246:Il4ra UTSW 7 125576405 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCACTGGAAAACTTGTCTAGAC -3'
(R):5'- TACAGAAGCCTGCCCACTTC -3'

Sequencing Primer
(F):5'- TAGACAAGCTGCTGCCTTG -3'
(R):5'- CCACTTCCTGAAGGCAGAG -3'
Posted On2019-06-26