Incidental Mutation 'R7218:Tyk2'
ID561602
Institutional Source Beutler Lab
Gene Symbol Tyk2
Ensembl Gene ENSMUSG00000032175
Gene Nametyrosine kinase 2
SynonymsJTK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21104068-21131243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21105054 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1207 (C1207R)
Ref Sequence ENSEMBL: ENSMUSP00000150354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000216874]
Predicted Effect probably damaging
Transcript: ENSMUST00000001036
AA Change: C1207R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: C1207R

DomainStartEndE-ValueType
B41 29 301 1.51e-26 SMART
Blast:B41 408 460 3e-12 BLAST
SH2 470 562 1.26e-2 SMART
STYKc 612 886 8.89e-15 SMART
TyrKc 917 1189 6.48e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214454
AA Change: C1184R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216874
AA Change: C1207R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Tyk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Tyk2 APN 9 21120588 missense probably benign 0.27
IGL01015:Tyk2 APN 9 21120700 missense probably benign 0.00
IGL01096:Tyk2 APN 9 21108863 missense probably damaging 1.00
IGL01410:Tyk2 APN 9 21109364 missense probably damaging 1.00
IGL01613:Tyk2 APN 9 21120576 missense probably damaging 0.99
IGL01997:Tyk2 APN 9 21110494 missense probably damaging 1.00
IGL02249:Tyk2 APN 9 21120407 missense probably damaging 1.00
IGL02407:Tyk2 APN 9 21109227 splice site probably benign
IGL02538:Tyk2 APN 9 21111043 missense possibly damaging 0.94
IGL03185:Tyk2 APN 9 21109384 missense probably damaging 1.00
ANU74:Tyk2 UTSW 9 21116158 missense probably damaging 1.00
R0355:Tyk2 UTSW 9 21114190 splice site probably null
R0667:Tyk2 UTSW 9 21108871 missense probably damaging 1.00
R0862:Tyk2 UTSW 9 21116167 missense probably benign 0.00
R0883:Tyk2 UTSW 9 21111137 missense possibly damaging 0.61
R1554:Tyk2 UTSW 9 21107922 missense probably damaging 0.96
R1575:Tyk2 UTSW 9 21115462 missense probably benign 0.00
R1664:Tyk2 UTSW 9 21120353 missense probably damaging 1.00
R1676:Tyk2 UTSW 9 21115249 nonsense probably null
R1843:Tyk2 UTSW 9 21121554 nonsense probably null
R1871:Tyk2 UTSW 9 21121441 missense probably damaging 1.00
R2044:Tyk2 UTSW 9 21120341 missense probably damaging 1.00
R2137:Tyk2 UTSW 9 21110985 intron probably benign
R2197:Tyk2 UTSW 9 21115207 missense probably damaging 1.00
R2883:Tyk2 UTSW 9 21110587 missense probably benign 0.01
R2941:Tyk2 UTSW 9 21111119 missense probably benign 0.00
R3001:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3002:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3196:Tyk2 UTSW 9 21124032 missense possibly damaging 0.80
R3622:Tyk2 UTSW 9 21127310 missense probably damaging 0.98
R4024:Tyk2 UTSW 9 21115919 missense probably damaging 1.00
R4459:Tyk2 UTSW 9 21124415 missense probably damaging 1.00
R4604:Tyk2 UTSW 9 21108009 missense probably damaging 1.00
R4664:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4666:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4915:Tyk2 UTSW 9 21111137 missense probably benign 0.41
R4971:Tyk2 UTSW 9 21120501 critical splice donor site probably null
R5014:Tyk2 UTSW 9 21115830 splice site probably null
R5191:Tyk2 UTSW 9 21107497 missense probably damaging 0.98
R5305:Tyk2 UTSW 9 21109381 missense probably damaging 0.99
R5356:Tyk2 UTSW 9 21115744 missense probably benign 0.03
R5501:Tyk2 UTSW 9 21121612 missense probably damaging 1.00
R6025:Tyk2 UTSW 9 21115960 missense probably benign 0.05
R6113:Tyk2 UTSW 9 21107922 missense probably damaging 1.00
R6159:Tyk2 UTSW 9 21110504 missense probably damaging 0.99
R6608:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6610:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6612:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6870:Tyk2 UTSW 9 21124954 missense probably damaging 1.00
R7216:Tyk2 UTSW 9 21120526 missense probably benign 0.01
R7298:Tyk2 UTSW 9 21108860 missense probably benign 0.35
R7322:Tyk2 UTSW 9 21110204 missense probably benign
R7347:Tyk2 UTSW 9 21108034 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTTTCTTCCCAGCTAATGAAG -3'
(R):5'- TTACGACACAGGGCAGATGG -3'

Sequencing Primer
(F):5'- CTAATGAAGATGGGGGTCTCAACC -3'
(R):5'- GCAGATGGCCCCACAGC -3'
Posted On2019-06-26