Incidental Mutation 'R7218:Asap1'
ID561617
Institutional Source Beutler Lab
Gene Symbol Asap1
Ensembl Gene ENSMUSG00000022377
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain1
SynonymsDdef1, mKIAA1249
MMRRC Submission
Accession Numbers

Genbank: NM_010026; MGI: 1342335

Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location64086857-64382919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64130250 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 404 (T404M)
Ref Sequence ENSEMBL: ENSMUSP00000135643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023008] [ENSMUST00000110114] [ENSMUST00000110115] [ENSMUST00000175793] [ENSMUST00000175799] [ENSMUST00000176014] [ENSMUST00000176384] [ENSMUST00000177035] [ENSMUST00000177083] [ENSMUST00000177371] [ENSMUST00000177374]
Predicted Effect probably damaging
Transcript: ENSMUST00000023008
AA Change: T427M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023008
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110114
AA Change: T427M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105741
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110115
AA Change: T412M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105742
Gene: ENSMUSG00000022377
AA Change: T412M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 799 832 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
SH3 1073 1131 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175793
AA Change: T415M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135718
Gene: ENSMUSG00000022377
AA Change: T415M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 328 421 4.12e-15 SMART
ArfGap 442 565 2.18e-34 SMART
ANK 603 635 1.17e-1 SMART
ANK 639 668 3.46e-4 SMART
low complexity region 715 726 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 802 835 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 959 972 N/A INTRINSIC
low complexity region 1053 1065 N/A INTRINSIC
SH3 1076 1134 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175799
AA Change: T424M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135359
Gene: ENSMUSG00000022377
AA Change: T424M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 911 924 N/A INTRINSIC
low complexity region 1005 1017 N/A INTRINSIC
SH3 1028 1086 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176014
AA Change: T424M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135172
Gene: ENSMUSG00000022377
AA Change: T424M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 811 844 N/A INTRINSIC
low complexity region 853 862 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
SH3 1085 1143 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176384
AA Change: T427M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135190
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177035
AA Change: T412M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135346
Gene: ENSMUSG00000022377
AA Change: T412M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 899 912 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
SH3 1016 1074 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177083
AA Change: T392M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134877
Gene: ENSMUSG00000022377
AA Change: T392M

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 305 398 4.12e-15 SMART
ArfGap 419 542 2.18e-34 SMART
ANK 580 612 1.17e-1 SMART
ANK 616 645 3.46e-4 SMART
low complexity region 692 703 N/A INTRINSIC
low complexity region 757 768 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 821 830 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
SH3 1053 1111 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177371
AA Change: T404M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135643
Gene: ENSMUSG00000022377
AA Change: T404M

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 317 410 4.12e-15 SMART
ArfGap 431 554 2.18e-34 SMART
ANK 592 624 1.17e-1 SMART
ANK 628 657 3.46e-4 SMART
low complexity region 704 715 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 824 N/A INTRINSIC
low complexity region 833 842 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
SH3 1065 1123 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177374
AA Change: T427M

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134825
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:BAR 18 267 1.8e-11 PFAM
Pfam:BAR_3 52 286 1.2e-29 PFAM
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ADP-ribosylation factor (ARF) GTPase-activating protein. The GTPase-activating activity is stimulated by phosphatidylinositol 4,5-biphosphate (PIP2), and is greater towards ARF1 and ARF5, and lesser for ARF6. This gene maybe involved in regulation of membrane trafficking and cytoskeleton remodeling. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Asap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Asap1 APN 15 64119954 splice site probably benign
IGL00473:Asap1 APN 15 64173215 splice site probably benign
IGL00519:Asap1 APN 15 64110942 missense probably damaging 1.00
IGL01304:Asap1 APN 15 64312449 missense probably damaging 1.00
IGL01510:Asap1 APN 15 64158928 missense probably damaging 1.00
IGL02208:Asap1 APN 15 64122033 missense probably damaging 1.00
IGL02338:Asap1 APN 15 64123670 critical splice donor site probably null
IGL02429:Asap1 APN 15 64167740 missense probably damaging 1.00
IGL02565:Asap1 APN 15 64129165 splice site probably benign
IGL02644:Asap1 APN 15 64111062 missense probably damaging 1.00
IGL02684:Asap1 APN 15 64094169 missense probably benign
IGL02707:Asap1 APN 15 64129274 missense probably damaging 1.00
IGL03052:Asap1 APN 15 64153834 splice site probably benign
IGL03153:Asap1 APN 15 64160274 missense probably damaging 1.00
A4554:Asap1 UTSW 15 64124711 splice site probably benign
PIT4378001:Asap1 UTSW 15 64135848 missense probably damaging 0.99
R0081:Asap1 UTSW 15 64099564 missense probably damaging 1.00
R0555:Asap1 UTSW 15 64094364 missense probably damaging 1.00
R1414:Asap1 UTSW 15 64158884 missense possibly damaging 0.92
R1437:Asap1 UTSW 15 64120107 missense probably damaging 0.96
R1474:Asap1 UTSW 15 64120020 missense probably benign 0.01
R1489:Asap1 UTSW 15 64172730 missense probably damaging 1.00
R1553:Asap1 UTSW 15 64152852 missense probably benign 0.31
R1603:Asap1 UTSW 15 64129257 missense probably damaging 1.00
R1636:Asap1 UTSW 15 64123912 missense probably damaging 1.00
R1645:Asap1 UTSW 15 64089475 missense probably damaging 0.99
R1861:Asap1 UTSW 15 64135798 splice site probably benign
R2136:Asap1 UTSW 15 64110959 missense probably damaging 1.00
R2351:Asap1 UTSW 15 64135804 critical splice donor site probably null
R4436:Asap1 UTSW 15 64349843 missense probably benign 0.03
R4618:Asap1 UTSW 15 64152895 missense probably damaging 1.00
R4868:Asap1 UTSW 15 64094181 missense probably benign
R5077:Asap1 UTSW 15 64127423 missense probably damaging 1.00
R5333:Asap1 UTSW 15 64127414 missense possibly damaging 0.79
R5391:Asap1 UTSW 15 64094052 missense possibly damaging 0.57
R5493:Asap1 UTSW 15 64130151 missense possibly damaging 0.85
R5665:Asap1 UTSW 15 64312453 missense probably damaging 1.00
R5756:Asap1 UTSW 15 64167707 missense probably damaging 1.00
R5790:Asap1 UTSW 15 64094265 missense probably damaging 1.00
R6139:Asap1 UTSW 15 64166539 missense possibly damaging 0.87
R6194:Asap1 UTSW 15 64129209 missense probably damaging 1.00
R6361:Asap1 UTSW 15 64349823 splice site probably null
R6751:Asap1 UTSW 15 64094412 missense possibly damaging 0.86
R7143:Asap1 UTSW 15 64191528 missense probably damaging 1.00
R7225:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7305:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7310:Asap1 UTSW 15 64099530 critical splice donor site probably null
R7439:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7441:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7488:Asap1 UTSW 15 64120125 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CGACTACACAGAGAAGAGGCTC -3'
(R):5'- TGTGTTCAAACAGCCCTAACC -3'

Sequencing Primer
(F):5'- TCGACAGGCCAGTGTGC -3'
(R):5'- GTGTTCAAACAGCCCTAACCATCTC -3'
Posted On2019-06-26