Incidental Mutation 'R7218:Yars2'
ID561620
Institutional Source Beutler Lab
Gene Symbol Yars2
Ensembl Gene ENSMUSG00000022792
Gene Nametyrosyl-tRNA synthetase 2 (mitochondrial)
Synonyms2210023C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R7218 (G1)
Quality Score168.009
Status Validated
Chromosome16
Chromosomal Location16302965-16309640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16303318 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 112 (A112V)
Ref Sequence ENSEMBL: ENSMUSP00000055277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059955] [ENSMUST00000159683] [ENSMUST00000159962] [ENSMUST00000162734]
Predicted Effect probably damaging
Transcript: ENSMUST00000059955
AA Change: A112V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055277
Gene: ENSMUSG00000022792
AA Change: A112V

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 370 5.9e-74 PFAM
Blast:S4 403 466 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159683
AA Change: A112V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124606
Gene: ENSMUSG00000022792
AA Change: A112V

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159962
AA Change: A112V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125252
Gene: ENSMUSG00000022792
AA Change: A112V

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162734
SMART Domains Protein: ENSMUSP00000125496
Gene: ENSMUSG00000022792

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 102 7.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that catalyzes the attachment of tyrosine to tRNA(Tyr). Mutations in this gene are associated with myopathy with lactic acidosis and sideroblastic anemia type 2 (MLASA2). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Yars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Yars2 APN 16 16303321 missense probably damaging 0.99
IGL01061:Yars2 APN 16 16306542 nonsense probably null
IGL01062:Yars2 APN 16 16306542 nonsense probably null
IGL01063:Yars2 APN 16 16306542 nonsense probably null
IGL01066:Yars2 APN 16 16306542 nonsense probably null
IGL01069:Yars2 APN 16 16306542 nonsense probably null
IGL01070:Yars2 APN 16 16306542 nonsense probably null
IGL02928:Yars2 APN 16 16303546 missense probably damaging 1.00
R4718:Yars2 UTSW 16 16309340 missense probably benign 0.00
R5012:Yars2 UTSW 16 16303584 missense probably damaging 0.98
R5498:Yars2 UTSW 16 16306523 missense possibly damaging 0.62
R5585:Yars2 UTSW 16 16304620 missense probably damaging 1.00
R5935:Yars2 UTSW 16 16309471 missense probably benign 0.02
R6302:Yars2 UTSW 16 16304574 missense probably damaging 1.00
R6344:Yars2 UTSW 16 16303035 missense probably benign
R7235:Yars2 UTSW 16 16304692 missense probably benign
X0062:Yars2 UTSW 16 16303018 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CGGCTTGTTCAAGGAGTTCTTC -3'
(R):5'- AAATCCACCAGGTGCTGCTC -3'

Sequencing Primer
(F):5'- AGTTCTTCCCCGAGAGCG -3'
(R):5'- TGCTGCTCCTGGAACCAG -3'
Posted On2019-06-26