Incidental Mutation 'R7218:Tbc1d23'
ID561621
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene NameTBC1 domain family, member 23
Synonyms4930451A13Rik, D030022P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R7218 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location57168862-57231504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57170382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 678 (V678M)
Ref Sequence ENSEMBL: ENSMUSP00000023431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000023432] [ENSMUST00000226586]
Predicted Effect probably damaging
Transcript: ENSMUST00000023431
AA Change: V678M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749
AA Change: V678M

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023432
SMART Domains Protein: ENSMUSP00000023432
Gene: ENSMUSG00000022751

DomainStartEndE-ValueType
Pfam:CN_hydrolase 5 256 3.5e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226586
AA Change: V693M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 57171776 missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57192675 missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57186685 splice site probably benign
IGL01980:Tbc1d23 APN 16 57189252 splice site probably benign
IGL02457:Tbc1d23 APN 16 57170391 missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57184415 missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57214262 missense probably damaging 1.00
R0386:Tbc1d23 UTSW 16 57189273 missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 57171814 missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R1124:Tbc1d23 UTSW 16 57214162 critical splice donor site probably null
R1430:Tbc1d23 UTSW 16 57214210 missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 57173100 missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57189351 missense probably benign
R4675:Tbc1d23 UTSW 16 57182962 missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57198895 frame shift probably null
R4781:Tbc1d23 UTSW 16 57218415 missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57192628 missense probably benign 0.01
R4895:Tbc1d23 UTSW 16 57198857 critical splice donor site probably null
R5389:Tbc1d23 UTSW 16 57198928 missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57198309 missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 57173150 missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57231350 missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57182903 missense probably damaging 0.98
R6232:Tbc1d23 UTSW 16 57170433 missense probably benign 0.39
R6484:Tbc1d23 UTSW 16 57178016 missense probably damaging 1.00
R6670:Tbc1d23 UTSW 16 57214217 missense probably benign 0.00
R6957:Tbc1d23 UTSW 16 57208323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCATCCCGGTATTGATTAC -3'
(R):5'- GACAGCAAGGACGGTGATTTAC -3'

Sequencing Primer
(F):5'- CCCGGTATTGATTACAATAATTTGC -3'
(R):5'- GAAAAGTCCCATGGCTTTGAC -3'
Posted On2019-06-26