Incidental Mutation 'R7218:Fance'
ID561622
Institutional Source Beutler Lab
Gene Symbol Fance
Ensembl Gene ENSMUSG00000007570
Gene NameFanconi anemia, complementation group E
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28313530-28326568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28326174 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 143 (D143G)
Ref Sequence ENSEMBL: ENSMUSP00000110451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042334] [ENSMUST00000088007] [ENSMUST00000114801] [ENSMUST00000114803] [ENSMUST00000114804] [ENSMUST00000123248] [ENSMUST00000129935] [ENSMUST00000146104] [ENSMUST00000156505]
Predicted Effect probably benign
Transcript: ENSMUST00000042334
SMART Domains Protein: ENSMUSP00000048469
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 12 213 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088007
AA Change: D188G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000085322
Gene: ENSMUSG00000007570
AA Change: D188G

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 212 5.9e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114801
AA Change: D101G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110449
Gene: ENSMUSG00000007570
AA Change: D101G

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 98 1.8e-32 PFAM
Pfam:FA_FANCE 93 125 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114803
AA Change: D143G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110451
Gene: ENSMUSG00000007570
AA Change: D143G

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 167 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114804
AA Change: D146G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110452
Gene: ENSMUSG00000007570
AA Change: D146G

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 140 3.7e-56 PFAM
Pfam:FA_FANCE 137 170 6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123248
SMART Domains Protein: ENSMUSP00000119663
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 154 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129935
SMART Domains Protein: ENSMUSP00000114141
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 3 57 1.3e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146104
AA Change: T125A
SMART Domains Protein: ENSMUSP00000114386
Gene: ENSMUSG00000007570
AA Change: T125A

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 96 7.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156505
SMART Domains Protein: ENSMUSP00000118622
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 67 4e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes the complementation group E subunit of the multimeric Fanconi anemia (FA) nuclear complex composed of proteins encoded by over ten Fanconi anemia complementation (FANC) group genes: FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The FA complex is necessary for protection against DNA damage. This gene product is required for the nuclear accumulation of FANCC and provides a critical bridge between the FA complex and FANCD2. Defects in the related human gene are a cause of Fanconi anemia, a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. Translation of this protein is initiated at a non-AUG (CUG) start codon, which is inferred from the related human gene and the notion that this protein is functionally indispensable. Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Fance
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Fance APN 17 28322779 intron probably benign
R2068:Fance UTSW 17 28320825 missense possibly damaging 0.91
R2513:Fance UTSW 17 28318094 missense probably benign 0.00
R4483:Fance UTSW 17 28315807 unclassified probably benign
R4579:Fance UTSW 17 28317151 splice site probably null
R4664:Fance UTSW 17 28315662 unclassified probably benign
R4719:Fance UTSW 17 28318319 splice site probably benign
R5225:Fance UTSW 17 28315615 unclassified probably benign
R5404:Fance UTSW 17 28318060 missense probably null 1.00
R6165:Fance UTSW 17 28326094 missense probably benign 0.28
R6845:Fance UTSW 17 28317591 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAAGCCCATCTATCAGTGGG -3'
(R):5'- TCAATATGGCCCCTGCAGAG -3'

Sequencing Primer
(F):5'- TGAGCTCCACTGCTGATAGAACTC -3'
(R):5'- CTGCAGAGCCTGGGGTG -3'
Posted On2019-06-26