Incidental Mutation 'R7220:Rnpc3'
ID561717
Institutional Source Beutler Lab
Gene Symbol Rnpc3
Ensembl Gene ENSMUSG00000027981
Gene NameRNA-binding region (RNP1, RRM) containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7220 (G1)
Quality Score187.009
Status Not validated
Chromosome3
Chromosomal Location113605067-113630149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113628355 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 77 (A77V)
Ref Sequence ENSEMBL: ENSMUSP00000089792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092154] [ENSMUST00000106535] [ENSMUST00000106536]
Predicted Effect probably benign
Transcript: ENSMUST00000092154
AA Change: A77V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089792
Gene: ENSMUSG00000027981
AA Change: A77V

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106535
AA Change: A77V

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102145
Gene: ENSMUSG00000027981
AA Change: A77V

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 4.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106536
AA Change: A77V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102146
Gene: ENSMUSG00000027981
AA Change: A77V

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000115492
Gene: ENSMUSG00000027981
AA Change: A25V

DomainStartEndE-ValueType
Blast:RRM 2 47 8e-22 BLAST
SCOP:d1urna_ 3 53 4e-4 SMART
low complexity region 167 202 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
RRM 368 446 1.35e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Rnpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Rnpc3 APN 3 113608399 missense probably damaging 1.00
IGL02750:Rnpc3 APN 3 113621939 missense possibly damaging 0.81
R0316:Rnpc3 UTSW 3 113629973 missense probably damaging 1.00
R0420:Rnpc3 UTSW 3 113621869 missense probably benign 0.00
R0601:Rnpc3 UTSW 3 113620106 missense probably benign 0.18
R1051:Rnpc3 UTSW 3 113629946 missense possibly damaging 0.94
R1386:Rnpc3 UTSW 3 113613784 nonsense probably null
R1865:Rnpc3 UTSW 3 113621910 nonsense probably null
R1870:Rnpc3 UTSW 3 113611055 unclassified probably benign
R2045:Rnpc3 UTSW 3 113608360 missense possibly damaging 0.90
R4447:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4450:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4934:Rnpc3 UTSW 3 113624979 missense possibly damaging 0.86
R5436:Rnpc3 UTSW 3 113624999 missense probably damaging 1.00
R5474:Rnpc3 UTSW 3 113615509 nonsense probably null
R5498:Rnpc3 UTSW 3 113611207 critical splice donor site probably null
R5505:Rnpc3 UTSW 3 113615453 missense probably damaging 0.98
R5868:Rnpc3 UTSW 3 113616711 intron probably null
R6123:Rnpc3 UTSW 3 113609056 unclassified probably null
R7240:Rnpc3 UTSW 3 113616831 missense probably damaging 1.00
X0012:Rnpc3 UTSW 3 113629909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAAGCTCTGATATCTGTCAAG -3'
(R):5'- CGTGCAAGTCCAAGAAGTCTG -3'

Sequencing Primer
(F):5'- ATCTGTCAAGCCAATTGTGACC -3'
(R):5'- GTCTGACCCTAGAAGATTCGG -3'
Posted On2019-06-26