Incidental Mutation 'R7220:B020004J07Rik'
ID561721
Institutional Source Beutler Lab
Gene Symbol B020004J07Rik
Ensembl Gene ENSMUSG00000035201
Gene NameRIKEN cDNA B020004J07 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7220 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101834969-101844023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101837368 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 106 (F106S)
Ref Sequence ENSEMBL: ENSMUSP00000081421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084386] [ENSMUST00000106919]
Predicted Effect probably benign
Transcript: ENSMUST00000084386
AA Change: F106S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081421
Gene: ENSMUSG00000035201
AA Change: F106S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106919
AA Change: F106S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102532
Gene: ENSMUSG00000035201
AA Change: F106S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in B020004J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:B020004J07Rik APN 4 101835532 missense probably benign
IGL01615:B020004J07Rik APN 4 101837004 missense possibly damaging 0.63
IGL01765:B020004J07Rik APN 4 101837852 missense probably benign 0.03
IGL02228:B020004J07Rik APN 4 101836858 missense probably benign 0.03
IGL02276:B020004J07Rik APN 4 101838109 missense possibly damaging 0.89
IGL02548:B020004J07Rik APN 4 101835573 missense probably damaging 0.99
IGL03226:B020004J07Rik APN 4 101835397 missense probably benign 0.00
R0124:B020004J07Rik UTSW 4 101835373 makesense probably null
R0449:B020004J07Rik UTSW 4 101836961 missense probably benign 0.01
R0573:B020004J07Rik UTSW 4 101835414 missense probably damaging 0.96
R1159:B020004J07Rik UTSW 4 101838027 missense possibly damaging 0.54
R1689:B020004J07Rik UTSW 4 101837179 missense possibly damaging 0.63
R1857:B020004J07Rik UTSW 4 101835573 missense probably damaging 1.00
R1861:B020004J07Rik UTSW 4 101836938 missense probably benign
R2570:B020004J07Rik UTSW 4 101837246 missense probably benign 0.01
R3886:B020004J07Rik UTSW 4 101835723 missense probably benign 0.09
R4922:B020004J07Rik UTSW 4 101835532 missense probably benign
R4984:B020004J07Rik UTSW 4 101835599 missense possibly damaging 0.63
R5503:B020004J07Rik UTSW 4 101835802 missense probably benign 0.00
R6230:B020004J07Rik UTSW 4 101837214 missense probably damaging 0.96
R6831:B020004J07Rik UTSW 4 101836897 missense probably benign 0.26
R7172:B020004J07Rik UTSW 4 101836996 missense probably benign 0.00
R7201:B020004J07Rik UTSW 4 101838141 critical splice acceptor site probably null
R7253:B020004J07Rik UTSW 4 101835528 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ATCGTCATCTTCAGACAGCATAGC -3'
(R):5'- TGTCTCCAGATGCAGCTCATG -3'

Sequencing Primer
(F):5'- TTGTTGGGCCCACTGCAG -3'
(R):5'- AGCTCATGCAGTGTTCTTGC -3'
Posted On2019-06-26