Incidental Mutation 'R7220:Tecta'
ID561742
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7220 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42343887 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1672 (Q1672K)
Ref Sequence ENSEMBL: ENSMUSP00000040262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably benign
Transcript: ENSMUST00000042190
AA Change: Q1672K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: Q1672K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160940
AA Change: Q1667K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: Q1667K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTCGGTGCTAAGGATG -3'
(R):5'- AAGGTCACGTTGCTAGGCAG -3'

Sequencing Primer
(F):5'- GCCACACAGCTGGAACTTCTTG -3'
(R):5'- TTCAGGGCTAACCCAACA -3'
Posted On2019-06-26