Incidental Mutation 'R7220:Man1a'
ID561744
Institutional Source Beutler Lab
Gene Symbol Man1a
Ensembl Gene ENSMUSG00000003746
Gene Namemannosidase 1, alpha
Synonymsmannosyl-oligosaccharide alpha-1,2-mannosidase, PCR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location53904785-54076609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53920235 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 454 (S454A)
Ref Sequence ENSEMBL: ENSMUSP00000003843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003843] [ENSMUST00000105470] [ENSMUST00000218317] [ENSMUST00000220088]
PDB Structure
Structure of mouse Golgi alpha-1,2-mannosidase IA reveals the molecular basis for substrate specificity among Class I enzymes (family 47 glycosidases) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003843
AA Change: S454A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003843
Gene: ENSMUSG00000003746
AA Change: S454A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.6e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105470
AA Change: S454A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101110
Gene: ENSMUSG00000003746
AA Change: S454A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218317
Predicted Effect possibly damaging
Transcript: ENSMUST00000220088
AA Change: S545A

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class I mammalian Golgi 1,2-mannosidase which is a type II transmembrane protein. This protein catalyzes the hydrolysis of three terminal mannose residues from peptide-bound Man(9)-GlcNAc(2) oligosaccharides and belongs to family 47 of glycosyl hydrolases. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Brd4 T A 17: 32,225,583 Y139F unknown Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Man1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Man1a APN 10 53977013 splice site probably benign
IGL01146:Man1a APN 10 53907519 missense possibly damaging 0.90
IGL01412:Man1a APN 10 54074714 missense probably benign 0.00
IGL02009:Man1a APN 10 53925525 missense probably damaging 1.00
IGL02026:Man1a APN 10 54014473 missense probably damaging 1.00
IGL02745:Man1a APN 10 53977110 missense probably damaging 0.99
IGL02851:Man1a APN 10 53919244 missense probably damaging 1.00
IGL02929:Man1a APN 10 53925435 missense probably benign 0.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0101:Man1a UTSW 10 54075024 start codon destroyed probably null
R0200:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0463:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0947:Man1a UTSW 10 53933523 nonsense probably null
R1219:Man1a UTSW 10 53919153 splice site probably benign
R1876:Man1a UTSW 10 53919172 missense probably damaging 1.00
R2142:Man1a UTSW 10 53934998 missense probably damaging 1.00
R2219:Man1a UTSW 10 53977049 missense probably damaging 0.99
R3117:Man1a UTSW 10 54030794 missense probably damaging 0.97
R3119:Man1a UTSW 10 54030794 missense probably damaging 0.97
R4727:Man1a UTSW 10 53907572 splice site probably null
R4942:Man1a UTSW 10 53933490 critical splice donor site probably null
R5493:Man1a UTSW 10 54074480 missense probably benign 0.25
R5921:Man1a UTSW 10 53907510 missense probably damaging 0.97
R5965:Man1a UTSW 10 53933490 critical splice donor site probably benign
R6084:Man1a UTSW 10 53919211 missense probably damaging 1.00
R6199:Man1a UTSW 10 54014456 missense possibly damaging 0.70
R6362:Man1a UTSW 10 54074795 missense probably benign 0.25
R6543:Man1a UTSW 10 53934981 nonsense probably null
R6711:Man1a UTSW 10 53933492 missense probably benign 0.00
R6982:Man1a UTSW 10 54074723 missense possibly damaging 0.92
R7061:Man1a UTSW 10 53920235 missense probably damaging 1.00
R7063:Man1a UTSW 10 54030744 missense probably damaging 1.00
R7361:Man1a UTSW 10 53908009 missense probably damaging 1.00
R7392:Man1a UTSW 10 53919187 missense probably damaging 1.00
R7566:Man1a UTSW 10 53919234 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAAGTGCGGGCAATTTCAG -3'
(R):5'- ATCCTAACCAGATGAATAAGTGGAG -3'

Sequencing Primer
(F):5'- GCAATTTCAGCTCCGAGTTCAAGG -3'
(R):5'- TTGCTGTGAAAGGCAATCCC -3'
Posted On2019-06-26