Incidental Mutation 'R7220:Brd4'
ID561775
Institutional Source Beutler Lab
Gene Symbol Brd4
Ensembl Gene ENSMUSG00000024002
Gene Namebromodomain containing 4
SynonymsHUNK1, MCAP, WI-11513
MMRRC Submission
Accession Numbers

Genbank: NM_020508.3; NM_198094.2; MGI: 1888520

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7220 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32196274-32284722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32225583 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 139 (Y139F)
Ref Sequence ENSEMBL: ENSMUSP00000003726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003726] [ENSMUST00000120276] [ENSMUST00000121285] [ENSMUST00000125899] [ENSMUST00000127893]
Predicted Effect unknown
Transcript: ENSMUST00000003726
AA Change: Y139F
SMART Domains Protein: ENSMUSP00000003726
Gene: ENSMUSG00000024002
AA Change: Y139F

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1e-52 SMART
low complexity region 176 191 N/A INTRINSIC
low complexity region 198 224 N/A INTRINSIC
low complexity region 237 275 N/A INTRINSIC
low complexity region 295 305 N/A INTRINSIC
low complexity region 329 339 N/A INTRINSIC
BROMO 352 461 1.2e-48 SMART
coiled coil region 504 570 N/A INTRINSIC
Pfam:BET 611 675 6.4e-33 PFAM
low complexity region 701 722 N/A INTRINSIC
low complexity region 746 796 N/A INTRINSIC
low complexity region 828 854 N/A INTRINSIC
low complexity region 890 926 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
low complexity region 953 1005 N/A INTRINSIC
low complexity region 1013 1042 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1201 1212 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
coiled coil region 1261 1345 N/A INTRINSIC
Pfam:BRD4_CDT 1358 1400 3.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120276
AA Change: Y139F

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112474
Gene: ENSMUSG00000024002
AA Change: Y139F

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 3e-46 PDB
low complexity region 700 721 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121285
AA Change: Y139F
SMART Domains Protein: ENSMUSP00000113070
Gene: ENSMUSG00000024002
AA Change: Y139F

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 569 N/A INTRINSIC
PDB:2JNS|A 606 683 6e-46 PDB
low complexity region 700 721 N/A INTRINSIC
low complexity region 745 795 N/A INTRINSIC
low complexity region 827 853 N/A INTRINSIC
low complexity region 889 925 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 952 1004 N/A INTRINSIC
low complexity region 1012 1041 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1104 1119 N/A INTRINSIC
low complexity region 1134 1146 N/A INTRINSIC
low complexity region 1200 1211 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
coiled coil region 1260 1344 N/A INTRINSIC
low complexity region 1361 1381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125899
AA Change: Y139F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115277
Gene: ENSMUSG00000024002
AA Change: Y139F

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 144 5.02e-31 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127893
AA Change: Y139F
SMART Domains Protein: ENSMUSP00000115163
Gene: ENSMUSG00000024002
AA Change: Y139F

DomainStartEndE-ValueType
low complexity region 23 54 N/A INTRINSIC
BROMO 56 166 1.67e-50 SMART
low complexity region 197 223 N/A INTRINSIC
low complexity region 236 274 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
BROMO 351 460 1.81e-46 SMART
coiled coil region 503 531 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (75/75)
MGI Phenotype Strain: 2674141
Lethality: E3-E8
FUNCTION: This gene was temporarily named bromodomain-containing 5 (Brd5) and was renamed bromodomain-containing 4 (Brd4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trap null mutation die soon after implantation. Heterozygotes exhibit impaired pre- and postnatal growth, head malformations, lack of subcutaneous fat, cataracts, and abnormal liver cells. [provided by MGI curators]
Allele List at MGI

All alleles(161) : Targeted(1) Gene trapped(160)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,415 V170M possibly damaging Het
5031439G07Rik A T 15: 84,953,136 H325Q probably damaging Het
Aasdh T C 5: 76,901,925 I75V probably benign Het
Abca14 G A 7: 120,227,444 D438N possibly damaging Het
Abca8a T A 11: 110,089,967 I82F probably benign Het
Abca8b G T 11: 109,981,717 N19K probably damaging Het
Acan A G 7: 79,108,148 N506S Het
Alox12e C A 11: 70,315,905 R652L probably benign Het
Atad3a A G 4: 155,754,041 V173A probably benign Het
Atl3 A G 19: 7,529,068 K326R probably null Het
Atm G T 9: 53,511,917 C636* probably null Het
Atp2c2 G A 8: 119,745,561 M451I probably benign Het
B020004J07Rik A G 4: 101,837,368 F106S probably benign Het
Best1 A T 19: 9,992,115 M193K probably benign Het
Bmper G T 9: 23,399,355 G362C probably damaging Het
Bzw2 A T 12: 36,123,951 I108N possibly damaging Het
Cbs C A 17: 31,619,217 V353L probably benign Het
Ceacam20 A G 7: 19,967,753 T22A probably damaging Het
Ckap2l C T 2: 129,275,516 E580K probably damaging Het
Ckmt1 T C 2: 121,358,893 L15P possibly damaging Het
Clec18a G T 8: 111,081,572 P66H probably benign Het
Cma1 G T 14: 55,942,663 T95K probably benign Het
Csmd3 A G 15: 48,457,598 V272A probably damaging Het
Ctnna3 A T 10: 64,834,589 E632D probably benign Het
Ctsc T C 7: 88,297,153 L130P probably damaging Het
Frmpd2 A T 14: 33,507,475 R339S probably damaging Het
Frrs1 C A 3: 116,880,776 S69* probably null Het
Gcc2 A T 10: 58,280,594 E1108D probably benign Het
Gkn1 A T 6: 87,349,153 probably null Het
Gtf2a1 A T 12: 91,567,724 M252K probably benign Het
H2-Ob T C 17: 34,241,260 F115S probably damaging Het
Ighv1-53 T C 12: 115,158,515 N80S probably benign Het
Ighv1-67 T C 12: 115,604,046 K82R probably benign Het
Ints1 A T 5: 139,762,073 I1193N possibly damaging Het
Kmt2c A G 5: 25,344,925 F1353L probably damaging Het
Luc7l C T 17: 26,253,245 probably benign Het
Man1a A C 10: 53,920,235 S454A possibly damaging Het
Mars2 C A 1: 55,238,063 A275D probably damaging Het
Nrde2 A G 12: 100,130,919 V874A probably benign Het
Ociad1 A G 5: 73,313,466 T244A probably benign Het
Olfr139 A T 11: 74,044,763 D170E possibly damaging Het
Olfr25 A T 9: 38,329,750 L51F probably damaging Het
Olfr418 A G 1: 173,270,244 Y23C possibly damaging Het
Ovca2 A G 11: 75,178,675 C41R possibly damaging Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdh15 G A 10: 74,342,609 S566N possibly damaging Het
Pde3b A G 7: 114,536,062 I1038M probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pkhd1 T A 1: 20,523,126 T1588S possibly damaging Het
Ppig A G 2: 69,749,976 D618G unknown Het
Prss51 A T 14: 64,095,995 K18* probably null Het
Ptpra T A 2: 130,544,497 D622E probably damaging Het
Ptprs A T 17: 56,418,988 F1431L probably benign Het
Pxdn A G 12: 29,994,480 I486V probably benign Het
Rnpc3 G A 3: 113,628,355 A77V probably benign Het
Rtl10 T A 16: 18,501,276 C85* probably null Het
Skint10 A G 4: 112,728,973 S149P probably benign Het
Slc17a8 A C 10: 89,576,413 V570G probably benign Het
Slc25a42 A T 8: 70,189,498 V98E probably damaging Het
Smco2 A G 6: 146,858,865 E73G probably benign Het
Ss18 T C 18: 14,679,420 Y38C probably damaging Het
Sspo T A 6: 48,476,606 C2909* probably null Het
Tbccd1 A G 16: 22,833,997 Y125H probably benign Het
Tdrd9 A G 12: 112,014,454 T446A probably damaging Het
Tecta G T 9: 42,343,887 Q1672K probably benign Het
Tek G C 4: 94,804,304 W216C probably damaging Het
Timm17a C T 1: 135,313,575 probably null Het
Tlr4 A T 4: 66,839,951 H327L probably benign Het
Trim33 T C 3: 103,326,793 I449T possibly damaging Het
Vmn1r57 A G 7: 5,220,560 N28S probably null Het
Vmn2r117 T A 17: 23,477,203 H410L probably damaging Het
Vmn2r16 A G 5: 109,360,906 E500G probably damaging Het
Wif1 A G 10: 121,090,114 N245S possibly damaging Het
Other mutations in Brd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Brd4 APN 17 32198675 splice site probably benign
IGL01758:Brd4 APN 17 32212829 unclassified probably benign
IGL02750:Brd4 APN 17 32198379 unclassified probably benign
IGL03066:Brd4 APN 17 32199088 intron probably benign
IGL03338:Brd4 APN 17 32213072 missense probably damaging 1.00
Admirable UTSW 17 32225583 missense unknown
H8562:Brd4 UTSW 17 32229403 splice site probably benign
P0035:Brd4 UTSW 17 32212838 critical splice donor site probably null
R0243:Brd4 UTSW 17 32224123 missense probably benign 0.15
R0281:Brd4 UTSW 17 32213540 unclassified probably benign
R0331:Brd4 UTSW 17 32202515 missense probably benign 0.01
R0722:Brd4 UTSW 17 32212982 missense possibly damaging 0.76
R0750:Brd4 UTSW 17 32220252 missense probably benign 0.09
R1544:Brd4 UTSW 17 32198672 splice site probably benign
R1920:Brd4 UTSW 17 32198086 unclassified probably benign
R1922:Brd4 UTSW 17 32198086 unclassified probably benign
R1957:Brd4 UTSW 17 32221366 missense possibly damaging 0.50
R2240:Brd4 UTSW 17 32213639 unclassified probably benign
R2316:Brd4 UTSW 17 32212910 missense probably benign 0.03
R2333:Brd4 UTSW 17 32221457 missense probably damaging 0.97
R3809:Brd4 UTSW 17 32211270 missense possibly damaging 0.72
R4273:Brd4 UTSW 17 32214782 missense probably benign
R4595:Brd4 UTSW 17 32198922 missense probably damaging 0.97
R4854:Brd4 UTSW 17 32220237 missense probably damaging 0.96
R4923:Brd4 UTSW 17 32199240 missense probably benign 0.38
R5014:Brd4 UTSW 17 32198398 unclassified probably benign
R5757:Brd4 UTSW 17 32201298 unclassified probably benign
R5979:Brd4 UTSW 17 32198726 missense probably benign 0.32
R6212:Brd4 UTSW 17 32202449 missense probably damaging 0.98
R6394:Brd4 UTSW 17 32224147 nonsense probably null
R6643:Brd4 UTSW 17 32198496 missense unknown
R7024:Brd4 UTSW 17 32221910 utr 3 prime probably benign
R7033:Brd4 UTSW 17 32199015 missense probably benign 0.13
X0064:Brd4 UTSW 17 32201127 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGATGCTTCAGGCTAACAAGG -3'
(R):5'- GGAGTTAAGTAACAGTGGCCTTTG -3'

Sequencing Primer
(F):5'- TGCTTCAGGCTAACAAGGATAAC -3'
(R):5'- AAGTAACAGTGGCCTTTGATTTC -3'
Posted On2019-06-26