Incidental Mutation 'R7222:Slc39a10'
ID561859
Institutional Source Beutler Lab
Gene Symbol Slc39a10
Ensembl Gene ENSMUSG00000025986
Gene Namesolute carrier family 39 (zinc transporter), member 10
Synonyms2900042E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location46807544-46892852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46819292 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 615 (L615P)
Ref Sequence ENSEMBL: ENSMUSP00000027131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027131]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027131
AA Change: L615P

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: L615P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
low complexity region 224 244 N/A INTRINSIC
Pfam:Zip 406 607 9.9e-44 PFAM
Pfam:Zip 588 821 2.5e-69 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Slc39a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Slc39a10 APN 1 46819057 splice site probably benign
IGL01628:Slc39a10 APN 1 46835523 missense probably benign 0.23
IGL01939:Slc39a10 APN 1 46832735 missense probably benign 0.07
IGL02068:Slc39a10 APN 1 46819439 splice site probably benign
IGL02093:Slc39a10 APN 1 46835209 missense probably damaging 1.00
IGL02101:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02122:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02125:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02171:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02175:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02186:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02699:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02700:Slc39a10 APN 1 46818128 missense probably damaging 1.00
R0217:Slc39a10 UTSW 1 46835540 missense probably benign
R0704:Slc39a10 UTSW 1 46835861 missense possibly damaging 0.76
R0782:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R1527:Slc39a10 UTSW 1 46819262 missense probably benign
R1566:Slc39a10 UTSW 1 46836085 missense possibly damaging 0.90
R1568:Slc39a10 UTSW 1 46826215 missense probably benign 0.00
R1664:Slc39a10 UTSW 1 46826109 missense probably damaging 1.00
R1830:Slc39a10 UTSW 1 46836070 missense probably damaging 1.00
R1954:Slc39a10 UTSW 1 46835174 missense possibly damaging 0.50
R2327:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R3434:Slc39a10 UTSW 1 46835717 missense probably benign
R3761:Slc39a10 UTSW 1 46812125 missense possibly damaging 0.88
R4035:Slc39a10 UTSW 1 46812074 missense probably damaging 1.00
R4419:Slc39a10 UTSW 1 46810066 missense probably benign 0.42
R4675:Slc39a10 UTSW 1 46817984 intron probably benign
R4689:Slc39a10 UTSW 1 46836013 missense probably benign 0.00
R5310:Slc39a10 UTSW 1 46836125 missense probably damaging 1.00
R6073:Slc39a10 UTSW 1 46832612 missense possibly damaging 0.68
R6161:Slc39a10 UTSW 1 46827407 missense probably damaging 1.00
R6199:Slc39a10 UTSW 1 46835833 missense probably damaging 1.00
R6562:Slc39a10 UTSW 1 46835564 missense probably benign 0.02
R7087:Slc39a10 UTSW 1 46835720 missense probably damaging 1.00
R7286:Slc39a10 UTSW 1 46810070 missense probably damaging 0.97
R7568:Slc39a10 UTSW 1 46835130 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AAGTTGTGGATGCCGTCAC -3'
(R):5'- TGCCCAGGGTTAGATTAGCAC -3'

Sequencing Primer
(F):5'- GATCACCATCCAGGCTATATTGG -3'
(R):5'- CTGACGGATTTAGAAGCC -3'
Posted On2019-06-26