Incidental Mutation 'R7222:Cyp3a59'
ID561877
Institutional Source Beutler Lab
Gene Symbol Cyp3a59
Ensembl Gene ENSMUSG00000061292
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 59
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location146079257-146113287 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 146096575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035571] [ENSMUST00000035571] [ENSMUST00000199212]
Predicted Effect probably null
Transcript: ENSMUST00000035571
SMART Domains Protein: ENSMUSP00000049494
Gene: ENSMUSG00000061292

DomainStartEndE-ValueType
Pfam:p450 38 493 5.3e-128 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035571
SMART Domains Protein: ENSMUSP00000049494
Gene: ENSMUSG00000061292

DomainStartEndE-ValueType
Pfam:p450 38 493 5.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199212
SMART Domains Protein: ENSMUSP00000142591
Gene: ENSMUSG00000061292

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:p450 38 148 3.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Cyp3a59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Cyp3a59 APN 5 146102861 missense probably damaging 0.99
IGL01129:Cyp3a59 APN 5 146098279 missense probably benign 0.06
IGL01628:Cyp3a59 APN 5 146099819 missense possibly damaging 0.94
IGL01982:Cyp3a59 APN 5 146104735 missense probably benign 0.00
IGL02094:Cyp3a59 APN 5 146104821 missense probably benign 0.05
IGL02140:Cyp3a59 APN 5 146102880 missense probably damaging 1.00
IGL02350:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02357:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02445:Cyp3a59 APN 5 146096653 missense probably benign 0.00
IGL02681:Cyp3a59 APN 5 146090746 splice site probably benign
IGL02870:Cyp3a59 APN 5 146098184 missense probably benign
IGL03023:Cyp3a59 APN 5 146085850 missense probably benign 0.02
PIT4802001:Cyp3a59 UTSW 5 146102801 missense probably benign 0.00
R0220:Cyp3a59 UTSW 5 146098270 missense probably benign 0.02
R0532:Cyp3a59 UTSW 5 146096653 nonsense probably null
R1084:Cyp3a59 UTSW 5 146096674 missense probably benign
R1263:Cyp3a59 UTSW 5 146104711 missense probably damaging 1.00
R1573:Cyp3a59 UTSW 5 146102874 missense probably damaging 1.00
R1747:Cyp3a59 UTSW 5 146104758 missense probably benign
R1759:Cyp3a59 UTSW 5 146098250 missense probably benign 0.10
R1812:Cyp3a59 UTSW 5 146102811 missense probably damaging 1.00
R1937:Cyp3a59 UTSW 5 146094377 missense possibly damaging 0.80
R2026:Cyp3a59 UTSW 5 146096288 missense probably damaging 1.00
R2060:Cyp3a59 UTSW 5 146104714 missense probably damaging 1.00
R2355:Cyp3a59 UTSW 5 146099812 missense probably benign 0.09
R3721:Cyp3a59 UTSW 5 146096597 missense probably damaging 0.96
R4013:Cyp3a59 UTSW 5 146079383 missense probably benign 0.01
R4421:Cyp3a59 UTSW 5 146104903 splice site probably null
R4432:Cyp3a59 UTSW 5 146104786 missense probably benign 0.04
R4633:Cyp3a59 UTSW 5 146094438 missense probably damaging 1.00
R4843:Cyp3a59 UTSW 5 146096261 missense possibly damaging 0.61
R4886:Cyp3a59 UTSW 5 146087387 missense probably damaging 1.00
R5236:Cyp3a59 UTSW 5 146102825 missense probably benign 0.20
R5386:Cyp3a59 UTSW 5 146085768 missense probably benign 0.01
R5627:Cyp3a59 UTSW 5 146112854 missense probably benign 0.00
R5792:Cyp3a59 UTSW 5 146099851 missense possibly damaging 0.92
R5935:Cyp3a59 UTSW 5 146090645 nonsense probably null
R6531:Cyp3a59 UTSW 5 146098217 missense probably benign 0.00
R6790:Cyp3a59 UTSW 5 146096333 missense probably benign
R7108:Cyp3a59 UTSW 5 146096333 missense probably benign
Z1088:Cyp3a59 UTSW 5 146098222 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AACCCTGAGAATACGACATCTG -3'
(R):5'- GATGTATGGACCTTTGGTAAACAAC -3'

Sequencing Primer
(F):5'- TGAGAATACGACATCTGCAAACTG -3'
(R):5'- GGACCTTTGGTAAACAACAATTGAC -3'
Posted On2019-06-26