Incidental Mutation 'R7222:Dnah3'
ID561882
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120071523 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 651 (N651Y)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect probably benign
Transcript: ENSMUST00000046993
AA Change: N651Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: N651Y

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: N627Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 intron probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 unclassified probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGTGGTTGATGTGAGAAATC -3'
(R):5'- GCAAGGAGTCTAGCTCAAATAGTG -3'

Sequencing Primer
(F):5'- GATGTGAGAAATCATCCTCCATTGCC -3'
(R):5'- GAAATTGCATCCATGCACA -3'
Posted On2019-06-26