Incidental Mutation 'R7222:Osbpl7'
ID561894
Institutional Source Beutler Lab
Gene Symbol Osbpl7
Ensembl Gene ENSMUSG00000038534
Gene Nameoxysterol binding protein-like 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97050628-97068904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97060538 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 684 (T684A)
Ref Sequence ENSEMBL: ENSMUSP00000087474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090020] [ENSMUST00000168565]
Predicted Effect probably damaging
Transcript: ENSMUST00000090020
AA Change: T684A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087474
Gene: ENSMUSG00000038534
AA Change: T684A

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 138 154 N/A INTRINSIC
PH 174 270 7.76e-11 SMART
low complexity region 533 551 N/A INTRINSIC
Pfam:Oxysterol_BP 599 947 4.6e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168565
AA Change: T512A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126902
Gene: ENSMUSG00000038534
AA Change: T512A

DomainStartEndE-ValueType
PH 3 99 7.76e-11 SMART
Pfam:Oxysterol_BP 427 776 8.8e-140 PFAM
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Two transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Osbpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Osbpl7 APN 11 97052300 missense probably benign 0.00
IGL02041:Osbpl7 APN 11 97060508 missense probably benign 0.08
IGL02322:Osbpl7 APN 11 97056124 missense probably benign 0.18
IGL02396:Osbpl7 APN 11 97055551 missense probably damaging 1.00
IGL02441:Osbpl7 APN 11 97067702 missense probably damaging 1.00
IGL02668:Osbpl7 APN 11 97067205 missense possibly damaging 0.90
IGL03003:Osbpl7 APN 11 97050695 missense probably benign
R0377:Osbpl7 UTSW 11 97055934 missense probably damaging 0.99
R0549:Osbpl7 UTSW 11 97067542 missense probably damaging 1.00
R0848:Osbpl7 UTSW 11 97060524 missense probably damaging 1.00
R0919:Osbpl7 UTSW 11 97056101 missense possibly damaging 0.92
R1845:Osbpl7 UTSW 11 97059128 missense probably damaging 1.00
R2119:Osbpl7 UTSW 11 97056079 missense probably benign 0.02
R2418:Osbpl7 UTSW 11 97059178 missense probably benign 0.00
R2571:Osbpl7 UTSW 11 97054841 missense probably damaging 1.00
R3746:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3747:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3749:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R4590:Osbpl7 UTSW 11 97056272 missense probably damaging 1.00
R4602:Osbpl7 UTSW 11 97056269 missense possibly damaging 0.77
R4857:Osbpl7 UTSW 11 97056669 intron probably benign
R4898:Osbpl7 UTSW 11 97060150 missense probably damaging 0.98
R5160:Osbpl7 UTSW 11 97054556 missense probably damaging 1.00
R5292:Osbpl7 UTSW 11 97067953 missense probably benign 0.07
R5685:Osbpl7 UTSW 11 97060277 missense probably damaging 1.00
R5786:Osbpl7 UTSW 11 97065832 missense probably damaging 1.00
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6239:Osbpl7 UTSW 11 97052824 critical splice donor site probably null
R6715:Osbpl7 UTSW 11 97054599 missense probably damaging 1.00
R6920:Osbpl7 UTSW 11 97050758 missense probably damaging 0.99
R7179:Osbpl7 UTSW 11 97050836 missense probably benign 0.05
R7413:Osbpl7 UTSW 11 97054878 critical splice donor site probably null
X0020:Osbpl7 UTSW 11 97056559 missense probably benign 0.01
X0060:Osbpl7 UTSW 11 97060510 nonsense probably null
X0062:Osbpl7 UTSW 11 97065643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGACTTTGTTTGTGACAGG -3'
(R):5'- TCTCCCATAAGAAGAGCAGAGC -3'

Sequencing Primer
(F):5'- ACAGGCTGCTGTCCCCATC -3'
(R):5'- AGCAGAGCTCTCCTCCATTAG -3'
Posted On2019-06-26