Incidental Mutation 'R7222:Eva1c'
ID561904
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Nameeva-1 homolog C (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7222 (G1)
Quality Score217.468
Status Validated
Chromosome16
Chromosomal Location90826719-90905109 bp(+) (GRCm38)
Type of Mutationsmall deletion (8 aa in frame mutation)
DNA Base Change (assembly) AGGGTGTCCTGTACGAAGGACTTCCGGG to AGGG at 90904184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000231280] [ENSMUST00000231964]
Predicted Effect probably benign
Transcript: ENSMUST00000037539
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099543
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099548
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231280
Predicted Effect probably benign
Transcript: ENSMUST00000231964
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90904347 missense probably damaging 1.00
IGL02061:Eva1c APN 16 90866275 nonsense probably null
R0067:Eva1c UTSW 16 90866417 missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90866417 missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90876098 missense probably benign 0.03
R1330:Eva1c UTSW 16 90904396 missense probably damaging 1.00
R1765:Eva1c UTSW 16 90904247 missense probably benign 0.01
R1824:Eva1c UTSW 16 90866443 missense probably benign 0.01
R1880:Eva1c UTSW 16 90897415 missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90831325 missense probably benign 0.12
R4072:Eva1c UTSW 16 90904131 missense probably damaging 1.00
R4076:Eva1c UTSW 16 90904131 missense probably damaging 1.00
R4622:Eva1c UTSW 16 90897455 critical splice donor site probably null
R4760:Eva1c UTSW 16 90904250 missense probably benign 0.37
R4767:Eva1c UTSW 16 90904347 missense probably damaging 1.00
R5024:Eva1c UTSW 16 90876193 critical splice donor site probably null
R5304:Eva1c UTSW 16 90869663 missense probably damaging 1.00
R5559:Eva1c UTSW 16 90904251 missense probably benign 0.06
R6605:Eva1c UTSW 16 90866348 missense probably damaging 1.00
R7409:Eva1c UTSW 16 90869656 missense probably damaging 1.00
R7449:Eva1c UTSW 16 90876193 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGTCCACTGTGATGAAAAC -3'
(R):5'- GCGGCTTCTATAGAGCTATAGGC -3'

Sequencing Primer
(F):5'- AGATTTTACCACATGAGCCTGTCG -3'
(R):5'- GCTATAGGCTGGATATGAAGTCCTAC -3'
Posted On2019-06-26