Incidental Mutation 'R7222:Ranbp3'
ID561907
Institutional Source Beutler Lab
Gene Symbol Ranbp3
Ensembl Gene ENSMUSG00000002372
Gene NameRAN binding protein 3
Synonyms2610024N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56673225-56711769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 56710211 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 409 (V409G)
Ref Sequence ENSEMBL: ENSMUSP00000002445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002445] [ENSMUST00000067931] [ENSMUST00000164907]
Predicted Effect probably damaging
Transcript: ENSMUST00000002445
AA Change: V409G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002445
Gene: ENSMUSG00000002372
AA Change: V409G

DomainStartEndE-ValueType
low complexity region 275 287 N/A INTRINSIC
RanBD 305 432 1.7e-12 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067931
SMART Domains Protein: ENSMUSP00000064120
Gene: ENSMUSG00000054723

DomainStartEndE-ValueType
coiled coil region 7 45 N/A INTRINSIC
low complexity region 112 132 N/A INTRINSIC
low complexity region 140 150 N/A INTRINSIC
low complexity region 159 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164907
SMART Domains Protein: ENSMUSP00000132817
Gene: ENSMUSG00000054723

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
low complexity region 48 58 N/A INTRINSIC
low complexity region 67 74 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Ranbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ranbp3 APN 17 56709238 missense probably damaging 1.00
IGL02801:Ranbp3 APN 17 56710766 missense probably benign
IGL03004:Ranbp3 APN 17 56707207 missense probably damaging 1.00
Waif UTSW 17 56677208 intron probably null
R0094:Ranbp3 UTSW 17 56709338 unclassified probably benign
R0139:Ranbp3 UTSW 17 56709272 missense possibly damaging 0.95
R0419:Ranbp3 UTSW 17 56708219 missense possibly damaging 0.92
R0426:Ranbp3 UTSW 17 56707169 missense probably benign
R0629:Ranbp3 UTSW 17 56708200 missense possibly damaging 0.95
R0632:Ranbp3 UTSW 17 56702896 splice site probably benign
R1495:Ranbp3 UTSW 17 56705527 missense probably benign 0.03
R1525:Ranbp3 UTSW 17 56710865 missense possibly damaging 0.52
R2044:Ranbp3 UTSW 17 56673367 start gained probably benign
R2093:Ranbp3 UTSW 17 56710145 missense probably damaging 1.00
R4649:Ranbp3 UTSW 17 56696640 critical splice donor site probably null
R4780:Ranbp3 UTSW 17 56673346 start gained probably benign
R5568:Ranbp3 UTSW 17 56701543 critical splice donor site probably null
R5642:Ranbp3 UTSW 17 56710703 missense probably benign 0.01
R5806:Ranbp3 UTSW 17 56710717 missense probably benign 0.01
R5875:Ranbp3 UTSW 17 56707955 critical splice donor site probably null
R6142:Ranbp3 UTSW 17 56686018 missense probably benign 0.33
R6250:Ranbp3 UTSW 17 56677208 intron probably null
R6745:Ranbp3 UTSW 17 56709308 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGCAGTCTCTATCTCAGTGTACC -3'
(R):5'- CCCTTGATGTCTAACCGAGG -3'

Sequencing Primer
(F):5'- TCCCCAAGGGCATGTCTC -3'
(R):5'- CTTGATGTCTAACCGAGGGGACAG -3'
Posted On2019-06-26