Incidental Mutation 'R7222:Olfr1417'
ID561908
Institutional Source Beutler Lab
Gene Symbol Olfr1417
Ensembl Gene ENSMUSG00000048292
Gene Nameolfactory receptor 1417
SynonymsGA_x6K02T2RE5P-2172809-2171862, MOR266-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11826803-11839219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11828657 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 123 (R123L)
Ref Sequence ENSEMBL: ENSMUSP00000149141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061235] [ENSMUST00000214887]
Predicted Effect probably damaging
Transcript: ENSMUST00000061235
AA Change: R123L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062542
Gene: ENSMUSG00000048292
AA Change: R123L

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.3e-53 PFAM
Pfam:7tm_1 41 291 3.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214887
AA Change: R123L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Trim30a T C 7: 104,421,432 probably null Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Olfr1417
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0530:Olfr1417 UTSW 19 11828192 missense probably benign 0.26
R1532:Olfr1417 UTSW 19 11828619 missense probably benign 0.00
R1730:Olfr1417 UTSW 19 11828081 missense probably benign 0.06
R2032:Olfr1417 UTSW 19 11828300 missense probably damaging 1.00
R2237:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2238:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2239:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R4959:Olfr1417 UTSW 19 11828936 missense probably benign
R4973:Olfr1417 UTSW 19 11828936 missense probably benign
R5015:Olfr1417 UTSW 19 11828118 missense probably benign 0.00
R6799:Olfr1417 UTSW 19 11828814 missense possibly damaging 0.91
R6984:Olfr1417 UTSW 19 11828304 missense probably damaging 1.00
R7063:Olfr1417 UTSW 19 11828184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAGAGTGGCCTCATGGAC -3'
(R):5'- TGGCTAGCCTGGAGATCTTC -3'

Sequencing Primer
(F):5'- ACATGCCAGTCTCATGACAGGG -3'
(R):5'- GGCTAGCCTGGAGATCTTCTATTC -3'
Posted On2019-06-26