Incidental Mutation 'R7223:Snap91'
ID561946
Institutional Source Beutler Lab
Gene Symbol Snap91
Ensembl Gene ENSMUSG00000033419
Gene Namesynaptosomal-associated protein 91
SynonymsF1-20, AP180, 91kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location86765923-86880654 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 86879557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036347] [ENSMUST00000074468] [ENSMUST00000074501] [ENSMUST00000098495] [ENSMUST00000191290]
Predicted Effect probably benign
Transcript: ENSMUST00000036347
SMART Domains Protein: ENSMUSP00000046189
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 3.27e-5 PROSPERO
internal_repeat_1 584 611 3.27e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 728 757 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074468
SMART Domains Protein: ENSMUSP00000074066
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 6.86e-5 PROSPERO
internal_repeat_1 584 611 6.86e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
low complexity region 733 762 N/A INTRINSIC
low complexity region 833 847 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074501
SMART Domains Protein: ENSMUSP00000074095
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 440 469 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098495
SMART Domains Protein: ENSMUSP00000096096
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 396 426 N/A INTRINSIC
low complexity region 432 459 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
low complexity region 492 551 N/A INTRINSIC
internal_repeat_1 552 579 4.67e-5 PROSPERO
internal_repeat_1 577 604 4.67e-5 PROSPERO
low complexity region 609 627 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 698 727 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191290
SMART Domains Protein: ENSMUSP00000141065
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 5.2e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display postnatal growth retardation, limb clasping, altered behavior, defects in synaptic vesicle reformation, impaired neurotransmission, excitatory/inhibitory imbalance, epileptic seizures, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Snap91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Snap91 APN 9 86821737 missense probably benign 0.01
IGL01147:Snap91 APN 9 86798558 missense probably benign 0.37
IGL01358:Snap91 APN 9 86806560 missense probably damaging 1.00
IGL01501:Snap91 APN 9 86838125 missense probably damaging 0.99
IGL01883:Snap91 APN 9 86775612 missense probably damaging 1.00
IGL02632:Snap91 APN 9 86839522 missense possibly damaging 0.94
IGL02864:Snap91 APN 9 86838088 missense possibly damaging 0.95
IGL03276:Snap91 APN 9 86825012 missense possibly damaging 0.78
PIT4514001:Snap91 UTSW 9 86879433 missense possibly damaging 0.86
R1564:Snap91 UTSW 9 86792196 missense possibly damaging 0.85
R1804:Snap91 UTSW 9 86783417 missense probably benign 0.01
R1840:Snap91 UTSW 9 86815465 missense probably damaging 1.00
R1869:Snap91 UTSW 9 86790141 critical splice acceptor site probably null
R2156:Snap91 UTSW 9 86825077 missense probably damaging 1.00
R2221:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2223:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2233:Snap91 UTSW 9 86798571 missense probably benign 0.23
R2680:Snap91 UTSW 9 86879550 start codon destroyed probably null 1.00
R3077:Snap91 UTSW 9 86838854 missense possibly damaging 0.95
R3702:Snap91 UTSW 9 86806520 missense probably damaging 0.99
R3840:Snap91 UTSW 9 86839565 missense probably damaging 1.00
R3912:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3913:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3958:Snap91 UTSW 9 86838130 missense probably damaging 1.00
R3963:Snap91 UTSW 9 86775612 missense probably damaging 1.00
R4043:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4133:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4641:Snap91 UTSW 9 86879475 missense probably damaging 1.00
R4674:Snap91 UTSW 9 86792017 missense possibly damaging 0.73
R4770:Snap91 UTSW 9 86773601 missense possibly damaging 0.86
R4798:Snap91 UTSW 9 86783454 intron probably benign
R4849:Snap91 UTSW 9 86792560 missense possibly damaging 0.53
R4991:Snap91 UTSW 9 86790154 splice site probably null
R5200:Snap91 UTSW 9 86815444 missense probably damaging 1.00
R5354:Snap91 UTSW 9 86835124 missense possibly damaging 0.84
R5644:Snap91 UTSW 9 86790153 splice site probably null
R6029:Snap91 UTSW 9 86825080 splice site probably null
R6091:Snap91 UTSW 9 86839628 missense probably damaging 1.00
R6175:Snap91 UTSW 9 86825000 missense probably damaging 1.00
R6191:Snap91 UTSW 9 86838052 missense probably damaging 1.00
R6611:Snap91 UTSW 9 86790127 missense probably benign 0.33
R6764:Snap91 UTSW 9 86792181 missense probably benign 0.33
R6881:Snap91 UTSW 9 86773593 missense possibly damaging 0.73
R7201:Snap91 UTSW 9 86790146 splice site probably null
R7247:Snap91 UTSW 9 86792616 missense unknown
R7327:Snap91 UTSW 9 86773545 missense unknown
X0027:Snap91 UTSW 9 86798828 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTATTACAGACTGCCAAGGCC -3'
(R):5'- GATGGACCAACTGGGCTTG -3'

Sequencing Primer
(F):5'- TTGAGCCCCTATGGTCACG -3'
(R):5'- CAACTGGGCTTGGCGCG -3'
Posted On2019-06-26