Incidental Mutation 'R7223:Jarid2'
ID561968
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Namejumonji, AT rich interactive domain 2
Synonymsjumonji, Jmj
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location44729474-44921643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44896322 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 247 (T247A)
Ref Sequence ENSEMBL: ENSMUSP00000037774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173003] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044608
AA Change: T247A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: T247A

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173003
Predicted Effect possibly damaging
Transcript: ENSMUST00000173246
AA Change: T247A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: T247A

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173367
AA Change: T108A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518
AA Change: T108A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000173704
AA Change: T247A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: T247A

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: T209A

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Pcsk2 A G 2: 143,690,333 T134A possibly damaging Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1552:Jarid2 UTSW 13 44911199 missense probably damaging 1.00
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1844:Jarid2 UTSW 13 44902743 missense possibly damaging 0.71
R1896:Jarid2 UTSW 13 44884882 critical splice donor site probably null
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3110:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4128:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6619:Jarid2 UTSW 13 44874396 missense probably damaging 1.00
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R6970:Jarid2 UTSW 13 44902985 missense probably damaging 1.00
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCCTGGAGAATGGTTGAGTTAC -3'
(R):5'- ATAAACTGGGCCTTCTGTGG -3'

Sequencing Primer
(F):5'- GAGAATGGTTGAGTTACATGGTAAC -3'
(R):5'- TGGGACACTAGAAAGGCCCTC -3'
Posted On2019-06-26