Incidental Mutation 'R7224:Rcbtb1'
ID562058
Institutional Source Beutler Lab
Gene Symbol Rcbtb1
Ensembl Gene ENSMUSG00000035469
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R7224 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59201209-59237265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 59228379 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 390 (I390M)
Ref Sequence ENSEMBL: ENSMUSP00000022551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022551] [ENSMUST00000043227] [ENSMUST00000172810] [ENSMUST00000174009]
Predicted Effect probably damaging
Transcript: ENSMUST00000022551
AA Change: I390M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022551
Gene: ENSMUSG00000035469
AA Change: I390M

DomainStartEndE-ValueType
Pfam:RCC1 40 89 3.9e-8 PFAM
Pfam:RCC1 93 143 2e-13 PFAM
Pfam:RCC1_2 130 159 5.7e-12 PFAM
Pfam:RCC1 146 196 2.2e-13 PFAM
Pfam:RCC1_2 183 212 3.2e-8 PFAM
Pfam:RCC1 199 248 5.3e-17 PFAM
Pfam:RCC1_2 235 264 2.2e-11 PFAM
Pfam:RCC1 251 300 2.3e-15 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043227
AA Change: I390M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037030
Gene: ENSMUSG00000035469
AA Change: I390M

DomainStartEndE-ValueType
Pfam:RCC1 40 88 3.2e-7 PFAM
Pfam:RCC1 93 143 2.6e-13 PFAM
Pfam:RCC1_2 130 159 3.7e-12 PFAM
Pfam:RCC1 146 196 3.8e-14 PFAM
Pfam:RCC1_2 183 212 6.5e-8 PFAM
Pfam:RCC1 199 248 1.3e-16 PFAM
Pfam:RCC1_2 235 264 3.5e-10 PFAM
Pfam:RCC1 251 300 1.2e-13 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172810
Predicted Effect probably benign
Transcript: ENSMUST00000174009
Predicted Effect probably benign
Transcript: ENSMUST00000174830
SMART Domains Protein: ENSMUSP00000133421
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 1 48 2e-12 PFAM
Pfam:RCC1_2 33 64 4.8e-13 PFAM
Pfam:RCC1 51 93 7.8e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal RCC1 domain and a C-terminal BTB (broad complex, tramtrack and bric-a-brac) domain. In rat, over-expression of this gene in vascular smooth muscle cells induced cellular hypertrophy. In rat, the C-terminus of RCBTB1 interacts with the angiotensin II receptor-1A. In humans, this gene maps to a region of chromosome 13q that is frequently deleted in B-cell chronic lymphocytic leukemia and other lymphoid malignancies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Anxa6 A G 11: 54,986,167 F547L probably damaging Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Rcbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Rcbtb1 APN 14 59228305 missense probably benign 0.19
IGL01954:Rcbtb1 APN 14 59229967 missense probably damaging 1.00
IGL02458:Rcbtb1 APN 14 59229994 missense probably damaging 1.00
IGL02632:Rcbtb1 APN 14 59224682 missense probably damaging 0.99
IGL02689:Rcbtb1 APN 14 59224700 missense probably damaging 1.00
IGL03201:Rcbtb1 APN 14 59223278 missense probably damaging 1.00
IGL03411:Rcbtb1 APN 14 59209970 start codon destroyed probably null 1.00
R0014:Rcbtb1 UTSW 14 59235242 missense probably benign 0.35
R2858:Rcbtb1 UTSW 14 59221412 splice site probably null
R2877:Rcbtb1 UTSW 14 59210592 splice site probably benign
R3890:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3892:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3945:Rcbtb1 UTSW 14 59224776 critical splice donor site probably null
R6869:Rcbtb1 UTSW 14 59217602 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCGACTGTCTCTTGAGCTTTG -3'
(R):5'- TACAATGTCCAGGACTGCAGAG -3'

Sequencing Primer
(F):5'- AGCTTTGTGTGTTAACAGTGTCTC -3'
(R):5'- TGTCCAGGACTGCAGAGAACTAAAC -3'
Posted On2019-06-26