Incidental Mutation 'R7225:Ptpn18'
ID562071
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Nameprotein tyrosine phosphatase, non-receptor type 18
SynonymsPTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7225 (G1)
Quality Score183.009
Status Not validated
Chromosome1
Chromosomal Location34459762-34475733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34472846 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 366 (T366I)
Ref Sequence ENSEMBL: ENSMUSP00000027302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027302
AA Change: T366I

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: T366I

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188972
AA Change: T17I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000190122
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34463119 missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34459817 utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34471908 missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34470257 unclassified probably null
R0848:Ptpn18 UTSW 1 34462702 missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34463506 critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34463109 missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34470219 missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34471661 missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34471692 nonsense probably null
R4061:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34462742 missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34472960 missense probably benign
R4626:Ptpn18 UTSW 1 34471792 intron probably null
R4978:Ptpn18 UTSW 1 34469813 intron probably benign
R5260:Ptpn18 UTSW 1 34463510 splice site probably benign
R5335:Ptpn18 UTSW 1 34463178 missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34471663 missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34471563 splice site probably benign
R7038:Ptpn18 UTSW 1 34459825 start codon destroyed probably null 1.00
R7290:Ptpn18 UTSW 1 34462811 critical splice donor site probably null
X0065:Ptpn18 UTSW 1 34469891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTTCTGCCCTCAGGTGG -3'
(R):5'- AGGTACTTGTCCTCAGCTCC -3'

Sequencing Primer
(F):5'- TCCTGCTCTGAAGACTGGG -3'
(R):5'- GTACTTGTCCTCAGCTCCACACC -3'
Posted On2019-06-26