Incidental Mutation 'R7225:Jak3'
ID562100
Institutional Source Beutler Lab
Gene Symbol Jak3
Ensembl Gene ENSMUSG00000031805
Gene NameJanus kinase 3
Synonymsfae; wil
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R7225 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location71676296-71690575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71685511 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 869 (Q869K)
Ref Sequence ENSEMBL: ENSMUSP00000060073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034261] [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably benign
Transcript: ENSMUST00000034261
SMART Domains Protein: ENSMUSP00000034261
Gene: ENSMUSG00000079019

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
IlGF 26 120 2.46e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051995
AA Change: Q869K

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: Q869K

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110012
AA Change: Q869K

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: Q869K

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110013
AA Change: Q869K

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: Q869K

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Jak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACATCTCTTTGCTGGGC -3'
(R):5'- CTATAGAAGCTGGGATTCATGGGAG -3'

Sequencing Primer
(F):5'- GCTGGGCAAGGTGAGTG -3'
(R):5'- GGGAGTTAACGACCTTGTTCAAC -3'
Posted On2019-06-26