Incidental Mutation 'R7225:Vmn2r84'
ID562107
Institutional Source Beutler Lab
Gene Symbol Vmn2r84
Ensembl Gene ENSMUSG00000070601
Gene Namevomeronasal 2, receptor 84
SynonymsEG625068
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7225 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location130385316-130394241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130386683 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 556 (P556L)
Ref Sequence ENSEMBL: ENSMUSP00000092079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094502]
Predicted Effect probably damaging
Transcript: ENSMUST00000094502
AA Change: P556L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: P556L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 77 448 1.3e-27 PFAM
Pfam:NCD3G 508 561 6.9e-21 PFAM
Pfam:7tm_3 594 830 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Vmn2r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Vmn2r84 APN 10 130391225 missense possibly damaging 0.65
IGL01590:Vmn2r84 APN 10 130386095 missense probably damaging 1.00
IGL01639:Vmn2r84 APN 10 130389272 nonsense probably null
IGL01843:Vmn2r84 APN 10 130386279 missense probably benign
IGL01911:Vmn2r84 APN 10 130386408 missense probably damaging 0.99
IGL01937:Vmn2r84 APN 10 130385886 missense probably damaging 1.00
IGL01977:Vmn2r84 APN 10 130394066 missense probably benign 0.11
IGL02177:Vmn2r84 APN 10 130392012 missense probably benign 0.00
IGL02291:Vmn2r84 APN 10 130390748 missense probably damaging 1.00
IGL02590:Vmn2r84 APN 10 130391487 splice site probably benign
IGL02727:Vmn2r84 APN 10 130394126 missense possibly damaging 0.95
IGL02900:Vmn2r84 APN 10 130387992 splice site probably benign
IGL03383:Vmn2r84 APN 10 130386687 missense probably damaging 1.00
PIT4378001:Vmn2r84 UTSW 10 130385915 missense probably damaging 1.00
R0076:Vmn2r84 UTSW 10 130394193 missense probably damaging 1.00
R0089:Vmn2r84 UTSW 10 130386719 splice site probably benign
R0153:Vmn2r84 UTSW 10 130392008 missense probably benign 0.06
R0611:Vmn2r84 UTSW 10 130386122 missense probably damaging 1.00
R0883:Vmn2r84 UTSW 10 130391115 missense probably damaging 0.99
R1237:Vmn2r84 UTSW 10 130387856 splice site probably null
R1295:Vmn2r84 UTSW 10 130389139 missense probably benign 0.12
R1401:Vmn2r84 UTSW 10 130391990 missense possibly damaging 0.89
R1521:Vmn2r84 UTSW 10 130389268 missense probably benign 0.10
R1590:Vmn2r84 UTSW 10 130391480 critical splice acceptor site probably null
R1710:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R1891:Vmn2r84 UTSW 10 130386069 missense possibly damaging 0.78
R1956:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1957:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1962:Vmn2r84 UTSW 10 130390722 missense probably damaging 0.99
R1994:Vmn2r84 UTSW 10 130386009 missense probably damaging 1.00
R2124:Vmn2r84 UTSW 10 130391231 missense probably damaging 0.99
R2409:Vmn2r84 UTSW 10 130392071 missense probably damaging 0.99
R2474:Vmn2r84 UTSW 10 130386523 missense possibly damaging 0.50
R2851:Vmn2r84 UTSW 10 130394167 missense probably benign 0.05
R3508:Vmn2r84 UTSW 10 130390908 missense probably damaging 1.00
R3792:Vmn2r84 UTSW 10 130385800 makesense probably null
R4051:Vmn2r84 UTSW 10 130390898 missense probably damaging 1.00
R4061:Vmn2r84 UTSW 10 130386029 missense probably damaging 1.00
R4091:Vmn2r84 UTSW 10 130391369 missense probably damaging 1.00
R4190:Vmn2r84 UTSW 10 130391294 nonsense probably null
R4520:Vmn2r84 UTSW 10 130386522 missense probably damaging 1.00
R4584:Vmn2r84 UTSW 10 130390713 missense probably benign 0.00
R4588:Vmn2r84 UTSW 10 130385940 missense probably damaging 0.98
R4655:Vmn2r84 UTSW 10 130394104 nonsense probably null
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R5022:Vmn2r84 UTSW 10 130386548 missense probably damaging 1.00
R5146:Vmn2r84 UTSW 10 130386102 missense probably damaging 1.00
R5237:Vmn2r84 UTSW 10 130385994 missense probably damaging 0.99
R5695:Vmn2r84 UTSW 10 130389195 missense probably benign 0.12
R5793:Vmn2r84 UTSW 10 130385885 missense probably damaging 0.99
R6210:Vmn2r84 UTSW 10 130386245 missense probably damaging 1.00
R6286:Vmn2r84 UTSW 10 130390868 missense possibly damaging 0.65
R6580:Vmn2r84 UTSW 10 130389241 missense possibly damaging 0.93
R6607:Vmn2r84 UTSW 10 130390862 missense possibly damaging 0.87
R6818:Vmn2r84 UTSW 10 130386278 missense probably benign 0.09
R6956:Vmn2r84 UTSW 10 130389267 missense probably damaging 0.98
R6994:Vmn2r84 UTSW 10 130391007 missense possibly damaging 0.90
R7075:Vmn2r84 UTSW 10 130391072 missense probably damaging 0.99
R7252:Vmn2r84 UTSW 10 130386410 missense probably damaging 1.00
R7263:Vmn2r84 UTSW 10 130389208 missense probably damaging 1.00
R7297:Vmn2r84 UTSW 10 130391250 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCAGTTATTGGCCTTCACAATG -3'
(R):5'- GATCTGTTCCCTCACAATGCATAG -3'

Sequencing Primer
(F):5'- ATTGGCCTTCACAATGGGAGTATCC -3'
(R):5'- CCCTCACAATGCATAGGTTAATAGAG -3'
Posted On2019-06-26