Incidental Mutation 'R7225:Kcnf1'
ID562110
Institutional Source Beutler Lab
Gene Symbol Kcnf1
Ensembl Gene ENSMUSG00000051726
Gene Namepotassium voltage-gated channel, subfamily F, member 1
SynonymsLOC382571
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7225 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location17172100-17176888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17175693 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 176 (C176R)
Ref Sequence ENSEMBL: ENSMUSP00000131480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170580]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170580
AA Change: C176R

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131480
Gene: ENSMUSG00000051726
AA Change: C176R

DomainStartEndE-ValueType
BTB 33 147 2.32e-2 SMART
Pfam:Ion_trans 193 429 1.3e-49 PFAM
Pfam:Ion_trans_2 337 423 3.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Kcnf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Kcnf1 APN 12 17175348 missense probably benign 0.00
IGL02586:Kcnf1 APN 12 17176143 missense probably benign 0.27
R0931:Kcnf1 UTSW 12 17175141 missense possibly damaging 0.89
R1068:Kcnf1 UTSW 12 17175474 missense probably damaging 1.00
R1558:Kcnf1 UTSW 12 17175473 missense probably damaging 1.00
R1571:Kcnf1 UTSW 12 17175852 missense probably benign 0.00
R1607:Kcnf1 UTSW 12 17175732 missense probably benign 0.26
R2471:Kcnf1 UTSW 12 17175530 missense probably damaging 1.00
R4013:Kcnf1 UTSW 12 17175993 missense probably benign 0.01
R4095:Kcnf1 UTSW 12 17175479 missense possibly damaging 0.92
R4980:Kcnf1 UTSW 12 17175011 missense possibly damaging 0.88
R5157:Kcnf1 UTSW 12 17174741 missense probably benign
R6017:Kcnf1 UTSW 12 17175081 missense probably damaging 0.97
R7130:Kcnf1 UTSW 12 17175809 missense probably benign 0.27
R7308:Kcnf1 UTSW 12 17174729 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGTACTCCAGAGTGAACCAGC -3'
(R):5'- GCCCCATCTGCTTCAAGAAC -3'

Sequencing Primer
(F):5'- TCCAGAGTGAACCAGCCGATG -3'
(R):5'- CTGCTTCAAGAACGAGATGGACTTC -3'
Posted On2019-06-26