Incidental Mutation 'R7225:Paxbp1'
ID562120
Institutional Source Beutler Lab
Gene Symbol Paxbp1
Ensembl Gene ENSMUSG00000022974
Gene NamePAX3 and PAX7 binding protein 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7225 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location91014037-91044543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91027068 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 564 (E564G)
Ref Sequence ENSEMBL: ENSMUSP00000113835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118522] [ENSMUST00000145136]
Predicted Effect probably benign
Transcript: ENSMUST00000023698
SMART Domains Protein: ENSMUSP00000023698
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 60 86 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 434 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118522
AA Change: E564G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113835
Gene: ENSMUSG00000022974
AA Change: E564G

DomainStartEndE-ValueType
coiled coil region 3 28 N/A INTRINSIC
low complexity region 114 120 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
Pfam:GCFC 597 812 5.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145136
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may bind to GC-rich DNA sequences, which suggests its involvement in the regulation of transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Paxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Paxbp1 APN 16 91035916 splice site probably benign
IGL01705:Paxbp1 APN 16 91016988 missense probably benign 0.01
IGL02418:Paxbp1 APN 16 91034112 missense probably damaging 1.00
IGL02527:Paxbp1 APN 16 91037273 missense possibly damaging 0.57
IGL02661:Paxbp1 APN 16 91030525 missense probably benign 0.43
IGL02796:Paxbp1 APN 16 91025294 unclassified probably benign
IGL03336:Paxbp1 APN 16 91034172 missense probably benign
R0016:Paxbp1 UTSW 16 91036036 splice site probably benign
R0306:Paxbp1 UTSW 16 91022115 missense possibly damaging 0.54
R0331:Paxbp1 UTSW 16 91037367 missense possibly damaging 0.95
R0724:Paxbp1 UTSW 16 91036536 missense probably damaging 1.00
R0944:Paxbp1 UTSW 16 91023427 missense probably benign 0.25
R1348:Paxbp1 UTSW 16 91035016 missense probably damaging 0.97
R1909:Paxbp1 UTSW 16 91044305 unclassified probably benign
R2234:Paxbp1 UTSW 16 91034934 missense probably benign 0.05
R3156:Paxbp1 UTSW 16 91035990 missense probably benign 0.00
R3819:Paxbp1 UTSW 16 91022752 unclassified probably benign
R3910:Paxbp1 UTSW 16 91042681 missense probably damaging 1.00
R3949:Paxbp1 UTSW 16 91044017 missense probably damaging 1.00
R4109:Paxbp1 UTSW 16 91016898 missense probably benign 0.10
R4577:Paxbp1 UTSW 16 91015154 missense probably damaging 1.00
R4584:Paxbp1 UTSW 16 91034123 missense probably damaging 1.00
R4596:Paxbp1 UTSW 16 91030547 missense probably benign 0.28
R4837:Paxbp1 UTSW 16 91034978 nonsense probably null
R4877:Paxbp1 UTSW 16 91044311 unclassified probably benign
R5079:Paxbp1 UTSW 16 91025146 critical splice donor site probably null
R5086:Paxbp1 UTSW 16 91015216 unclassified probably benign
R5167:Paxbp1 UTSW 16 91022667 critical splice donor site probably null
R5291:Paxbp1 UTSW 16 91044352 start codon destroyed probably null
R5322:Paxbp1 UTSW 16 91015162 missense probably benign 0.01
R5529:Paxbp1 UTSW 16 91030513 missense possibly damaging 0.62
R5662:Paxbp1 UTSW 16 91037397 missense probably benign 0.45
R5814:Paxbp1 UTSW 16 91030496 missense probably damaging 1.00
R6422:Paxbp1 UTSW 16 91023444 missense probably benign 0.07
X0026:Paxbp1 UTSW 16 91027242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTACTGCGGACCACAG -3'
(R):5'- GAAGCCAGGAGGTGATTCTG -3'

Sequencing Primer
(F):5'- TTCCTCAGAGCTGACAGCCTG -3'
(R):5'- GAAAATACTGGCTGTGTCTTACTAGG -3'
Posted On2019-06-26