Incidental Mutation 'R7226:Ehmt1'
ID562134
Institutional Source Beutler Lab
Gene Symbol Ehmt1
Ensembl Gene ENSMUSG00000036893
Gene Nameeuchromatic histone methyltransferase 1
SynonymsKMT1D, 9230102N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location24789928-24919614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24804782 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1051 (D1051G)
Ref Sequence ENSEMBL: ENSMUSP00000119057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046227] [ENSMUST00000091348] [ENSMUST00000102938] [ENSMUST00000114418] [ENSMUST00000114432] [ENSMUST00000147147] [ENSMUST00000152636]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046227
AA Change: D1003G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046077
Gene: ENSMUSG00000036893
AA Change: D1003G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091348
AA Change: D1043G

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088906
Gene: ENSMUSG00000036893
AA Change: D1043G

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 763 792 2.02e-5 SMART
ANK 796 827 3.06e-5 SMART
ANK 829 859 1.69e-7 SMART
ANK 863 892 6.65e-6 SMART
ANK 896 925 7.71e-2 SMART
ANK 929 958 6.12e-5 SMART
ANK 962 995 7.29e2 SMART
PreSET 1002 1101 1.05e-30 SMART
SET 1117 1240 2.24e-43 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102938
AA Change: D1044G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100002
Gene: ENSMUSG00000036893
AA Change: D1044G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 770 799 2.02e-5 SMART
ANK 803 834 3.06e-5 SMART
ANK 836 866 1.69e-7 SMART
ANK 870 899 6.65e-6 SMART
ANK 903 932 7.71e-2 SMART
ANK 936 965 6.12e-5 SMART
ANK 969 1002 7.29e2 SMART
PreSET 1009 1108 1.05e-30 SMART
SET 1124 1247 2.24e-43 SMART
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114418
AA Change: D1003G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110061
Gene: ENSMUSG00000036893
AA Change: D1003G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114432
AA Change: D998G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110075
Gene: ENSMUSG00000036893
AA Change: D998G

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 717 746 2.02e-5 SMART
ANK 750 781 3.06e-5 SMART
ANK 783 813 1.69e-7 SMART
ANK 817 846 6.65e-6 SMART
ANK 850 879 7.71e-2 SMART
ANK 883 912 6.12e-5 SMART
ANK 916 949 7.29e2 SMART
PreSET 956 1055 1.05e-30 SMART
SET 1071 1194 2.24e-43 SMART
low complexity region 1211 1224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134775
Predicted Effect probably damaging
Transcript: ENSMUST00000147147
AA Change: D1051G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119057
Gene: ENSMUSG00000036893
AA Change: D1051G

DomainStartEndE-ValueType
low complexity region 252 271 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 352 364 N/A INTRINSIC
ANK 634 663 2.02e-5 SMART
ANK 667 698 3.06e-5 SMART
ANK 700 730 1.69e-7 SMART
ANK 734 763 6.65e-6 SMART
ANK 767 796 7.71e-2 SMART
ANK 800 829 6.12e-5 SMART
ANK 833 866 7.29e2 SMART
PreSET 873 972 1.05e-30 SMART
SET 988 1111 2.24e-43 SMART
low complexity region 1128 1141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152636
SMART Domains Protein: ENSMUSP00000141460
Gene: ENSMUSG00000036893

DomainStartEndE-ValueType
ANK 118 147 1.3e-7 SMART
ANK 151 182 2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that is part of the E2F6 complex, which represses transcription. The encoded protein methylates the Lys-9 position of histone H3, which tags it for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome, also known as Kleefstra syndrome). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Nullizygous embryos die circa E9.5 showing delayed growth and incomplete somite formation and neural groove closure. Heterozygotes show behavioral deficits and synaptic dysfunction. Homozygotes with a H3K9me1-binding mutant form show delayed prenatal growth and bone ossification and postnatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Ehmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ehmt1 APN 2 24838818 missense possibly damaging 0.81
IGL01403:Ehmt1 APN 2 24839626 missense possibly damaging 0.81
IGL01636:Ehmt1 APN 2 24839608 missense probably damaging 0.97
IGL01804:Ehmt1 APN 2 24791954 missense probably damaging 1.00
IGL01836:Ehmt1 APN 2 24863220 splice site probably null
IGL02740:Ehmt1 APN 2 24815839 splice site probably benign
IGL02750:Ehmt1 APN 2 24863869 missense probably damaging 1.00
IGL03026:Ehmt1 APN 2 24852734 missense probably benign
IGL02799:Ehmt1 UTSW 2 24815806 missense probably damaging 1.00
R0908:Ehmt1 UTSW 2 24804888 missense probably damaging 1.00
R1275:Ehmt1 UTSW 2 24886995 critical splice donor site probably null
R1665:Ehmt1 UTSW 2 24877464 missense probably damaging 1.00
R1707:Ehmt1 UTSW 2 24805138 missense probably benign
R1800:Ehmt1 UTSW 2 24884290 missense probably damaging 0.99
R2108:Ehmt1 UTSW 2 24837618 missense probably damaging 1.00
R2113:Ehmt1 UTSW 2 24804003 missense probably damaging 1.00
R2393:Ehmt1 UTSW 2 24806217 missense probably damaging 1.00
R2570:Ehmt1 UTSW 2 24815741 missense probably damaging 1.00
R3923:Ehmt1 UTSW 2 24884335 synonymous probably null
R4646:Ehmt1 UTSW 2 24891684 missense probably null 0.01
R4924:Ehmt1 UTSW 2 24839722 missense probably damaging 0.97
R4989:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5040:Ehmt1 UTSW 2 24884304 missense probably benign 0.19
R5110:Ehmt1 UTSW 2 24852790 missense probably benign 0.01
R5133:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5134:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5161:Ehmt1 UTSW 2 24858195 missense possibly damaging 0.71
R5162:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5183:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5184:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5208:Ehmt1 UTSW 2 24801533 missense probably benign 0.34
R5309:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5312:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5837:Ehmt1 UTSW 2 24863914 missense probably damaging 0.98
R5968:Ehmt1 UTSW 2 24836457 missense probably damaging 0.99
R6539:Ehmt1 UTSW 2 24804767 missense probably damaging 1.00
R6646:Ehmt1 UTSW 2 24806310 missense probably damaging 0.99
R7065:Ehmt1 UTSW 2 24840697 missense probably damaging 1.00
R7361:Ehmt1 UTSW 2 24856701 missense possibly damaging 0.94
R7373:Ehmt1 UTSW 2 24919573 start codon destroyed probably null 0.03
X0062:Ehmt1 UTSW 2 24863836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGACACTTAGGGCCTTC -3'
(R):5'- CTGTCTTCCATGAGGCAGAAG -3'

Sequencing Primer
(F):5'- CTAGGAAAACTGGAGTCCTGCC -3'
(R):5'- TCTTCCATGAGGCAGAAGCTAAAG -3'
Posted On2019-06-26