Incidental Mutation 'R7226:Cpsf6'
ID562169
Institutional Source Beutler Lab
Gene Symbol Cpsf6
Ensembl Gene ENSMUSG00000055531
Gene Namecleavage and polyadenylation specific factor 6
SynonymsHPBRII-4, CFIM68, 4733401N12Rik, HPBRII-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location117344673-117380015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 117361822 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 253 (W253G)
Ref Sequence ENSEMBL: ENSMUSP00000135150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069168] [ENSMUST00000175924] [ENSMUST00000176480] [ENSMUST00000176670] [ENSMUST00000176686] [ENSMUST00000177145]
Predicted Effect probably benign
Transcript: ENSMUST00000069168
SMART Domains Protein: ENSMUSP00000068408
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175924
SMART Domains Protein: ENSMUSP00000135848
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
PDB:3Q2T|D 19 91 3e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176480
SMART Domains Protein: ENSMUSP00000135550
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176670
AA Change: W253G
SMART Domains Protein: ENSMUSP00000135150
Gene: ENSMUSG00000055531
AA Change: W253G

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 232 N/A INTRINSIC
low complexity region 273 402 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 459 475 N/A INTRINSIC
low complexity region 526 588 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176686
SMART Domains Protein: ENSMUSP00000134823
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177145
SMART Domains Protein: ENSMUSP00000135136
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. The cleavage factor complex is composed of four polypeptides. This gene encodes the 68kD subunit. It has a domain organization reminiscent of spliceosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Cpsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cpsf6 APN 10 117366129 unclassified probably benign
IGL03018:Cpsf6 APN 10 117367956 missense probably benign 0.02
IGL03392:Cpsf6 APN 10 117367979 missense probably damaging 1.00
R1006:Cpsf6 UTSW 10 117366068 splice site probably benign
R1239:Cpsf6 UTSW 10 117361343 unclassified probably benign
R1611:Cpsf6 UTSW 10 117361828 intron probably benign
R2041:Cpsf6 UTSW 10 117359128 missense probably damaging 0.99
R2117:Cpsf6 UTSW 10 117366120 unclassified probably benign
R2225:Cpsf6 UTSW 10 117363036 unclassified probably benign
R4752:Cpsf6 UTSW 10 117361368 splice site probably benign
R5001:Cpsf6 UTSW 10 117367961 missense possibly damaging 0.71
R5176:Cpsf6 UTSW 10 117361284 unclassified probably benign
R5393:Cpsf6 UTSW 10 117362016 unclassified probably benign
R5696:Cpsf6 UTSW 10 117361029 unclassified probably benign
R7216:Cpsf6 UTSW 10 117362023 missense unknown
R7522:Cpsf6 UTSW 10 117367829 missense unknown
Z1088:Cpsf6 UTSW 10 117356041 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCTGATGCCAAGCTAGAAAGTG -3'
(R):5'- TCCTGGTGGGGACAGATTTC -3'

Sequencing Primer
(F):5'- TGAAACAGGGAAAATGGTCTTG -3'
(R):5'- AGATTTCCTGGGCCAGCAG -3'
Posted On2019-06-26