Incidental Mutation 'R7226:Nrn1'
ID562179
Institutional Source Beutler Lab
Gene Symbol Nrn1
Ensembl Gene ENSMUSG00000039114
Gene Nameneuritin 1
Synonymscpg15, 0710008J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location36725361-36735131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36730603 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 8 (R8C)
Ref Sequence ENSEMBL: ENSMUSP00000113721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037623] [ENSMUST00000122286] [ENSMUST00000223611] [ENSMUST00000224323] [ENSMUST00000224960]
Predicted Effect probably benign
Transcript: ENSMUST00000037623
SMART Domains Protein: ENSMUSP00000040900
Gene: ENSMUSG00000039114

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:NRN1 31 120 1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122286
AA Change: R8C

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113721
Gene: ENSMUSG00000039114
AA Change: R8C

DomainStartEndE-ValueType
Pfam:NRN1 47 133 2.7e-42 PFAM
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223611
Predicted Effect probably benign
Transcript: ENSMUST00000224323
AA Change: R8C

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000224960
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body length and body weight, delayed axonal, dendritic, and synaptic development, reduced dendritic spine maintenance leading to gradual spine loss, and impaired associative and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja3 T C 14: 57,035,893 T341A probably benign Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Nrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nrn1 APN 13 36730216 missense probably damaging 1.00
IGL02801:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02816:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02838:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02859:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02881:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02900:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02927:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02938:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02942:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL03144:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02802:Nrn1 UTSW 13 36730106 critical splice donor site probably null
R0172:Nrn1 UTSW 13 36730570 missense probably benign
R2126:Nrn1 UTSW 13 36730206 missense probably damaging 1.00
R5986:Nrn1 UTSW 13 36734264 nonsense probably null
R7426:Nrn1 UTSW 13 36726851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGACCTATTTGCATTCGGTCC -3'
(R):5'- TGAGCTCCTGGCAAAGATCC -3'

Sequencing Primer
(F):5'- ACCTCTGGTGCAGATGGAG -3'
(R):5'- TCCTGGCAAAGATCCGGGTAC -3'
Posted On2019-06-26