Incidental Mutation 'R7226:Gja3'
ID562183
Institutional Source Beutler Lab
Gene Symbol Gja3
Ensembl Gene ENSMUSG00000048582
Gene Namegap junction protein, alpha 3
SynonymsCx46, Gja-3, connexin 46, alpha 3 connexin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7226 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location57034460-57058100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57035893 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 341 (T341A)
Ref Sequence ENSEMBL: ENSMUSP00000059587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061614] [ENSMUST00000223792]
Predicted Effect probably benign
Transcript: ENSMUST00000061614
AA Change: T341A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000059587
Gene: ENSMUSG00000048582
AA Change: T341A

DomainStartEndE-ValueType
CNX 43 76 4.4e-21 SMART
low complexity region 103 116 N/A INTRINSIC
Connexin_CCC 165 231 3.36e-44 SMART
low complexity region 342 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223792
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a connexin and is a component of lens fiber gap junctions. Defects in this gene are a cause of zonular pulverulent cataract type 3 (CZP3). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutants exhibit lens nuclear cataracts associated with breakdown of gamma crystallin. Severity of the defect is influenced by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025B11Rik C T 15: 77,558,989 V17I unknown Het
Acad8 T A 9: 26,978,430 K323* probably null Het
Adam18 A T 8: 24,647,808 C339S probably damaging Het
Anxa7 A G 14: 20,460,195 F396L probably damaging Het
Ap2m1 T A 16: 20,539,451 V73D probably damaging Het
Asic2 A T 11: 80,971,514 I270N probably damaging Het
Atrn T G 2: 130,986,744 C1070G probably damaging Het
Bag6 A G 17: 35,142,945 N517S unknown Het
Cavin1 A C 11: 100,970,458 D3E probably benign Het
Cc2d2b T C 19: 40,791,307 L571P unknown Het
Ccbe1 A T 18: 66,083,128 C175S probably damaging Het
Cd19 A G 7: 126,414,823 L5P unknown Het
Cd46 A G 1: 195,042,006 S362P possibly damaging Het
Celf5 A G 10: 81,468,029 S198P probably damaging Het
Cep170b A G 12: 112,737,925 R706G possibly damaging Het
Chd3 G T 11: 69,369,211 R61S unknown Het
Cpsf6 A C 10: 117,361,822 W253G unknown Het
Cyp27a1 G A 1: 74,737,348 G481D probably damaging Het
Ddr1 C T 17: 35,691,147 D218N possibly damaging Het
Dhx34 A T 7: 16,198,876 V1046D probably damaging Het
Dhx9 A T 1: 153,465,677 D608E probably benign Het
Dnajc6 C A 4: 101,639,372 A912E probably damaging Het
Ehmt1 T C 2: 24,804,782 D1051G probably damaging Het
Fam217b C A 2: 178,421,203 A320E probably benign Het
Farsa T A 8: 84,864,060 I169N probably benign Het
Fbn2 A G 18: 58,037,070 C2210R probably damaging Het
Fbxo3 T A 2: 104,050,297 S251T probably benign Het
Fer1l6 C T 15: 58,590,535 T813I probably benign Het
Ftl1-ps1 A T 13: 74,406,995 E131V probably damaging Het
Gins3 T A 8: 95,637,871 I83N probably damaging Het
Gja5 A G 3: 97,050,858 Y77C probably damaging Het
Gm14085 C A 2: 122,522,532 R453S probably benign Het
Gm5096 A G 18: 87,757,466 D371G possibly damaging Het
Gm7247 A G 14: 51,365,351 K48R probably damaging Het
Gsx2 C A 5: 75,075,960 S67* probably null Het
H2-Q5 T A 17: 35,397,113 L217Q Het
Impg2 T A 16: 56,267,104 C1095* probably null Het
Itga7 G T 10: 128,940,932 W222L probably damaging Het
Kdm2b T A 5: 122,921,449 D530V possibly damaging Het
Klhdc8a A T 1: 132,302,606 D153V probably damaging Het
Lin28a C T 4: 134,006,308 G143S probably damaging Het
Memo1 A G 17: 74,202,343 L227S probably damaging Het
Mettl27 T A 5: 134,935,803 V138E probably damaging Het
Mov10 G T 3: 104,801,012 L474I probably damaging Het
Nat10 T C 2: 103,726,753 N852S probably benign Het
Nfkbie T C 17: 45,559,227 V166A possibly damaging Het
Nktr T C 9: 121,746,533 M369T probably damaging Het
Nlrp9a A T 7: 26,558,724 N589I probably benign Het
Nrn1 G A 13: 36,730,603 R8C probably benign Het
Nrsn1 A G 13: 25,253,468 I159T probably damaging Het
Olfr132 C T 17: 38,130,433 G253D probably benign Het
Olfr389 A G 11: 73,776,677 S217P possibly damaging Het
Olfr485 A T 7: 108,158,957 D305E probably benign Het
Olfr794 G A 10: 129,570,715 G20D probably benign Het
Osbp T A 19: 11,978,667 D385E probably benign Het
Pan3 T A 5: 147,526,992 N547K probably damaging Het
Pum1 C A 4: 130,771,981 T1036K probably damaging Het
Rad54l2 C A 9: 106,713,472 R485L probably damaging Het
Rps26 A T 10: 128,625,218 F101I unknown Het
Sdsl T C 5: 120,460,637 N138S probably benign Het
Slc39a6 A T 18: 24,584,027 H649Q probably damaging Het
Snip1 T A 4: 125,071,480 F226Y probably benign Het
Srrd T C 5: 112,337,456 T334A unknown Het
St14 C T 9: 31,100,152 D448N possibly damaging Het
Tmem270 T A 5: 134,901,684 Q241L probably benign Het
Tmem55a T A 4: 14,892,464 D109E probably damaging Het
Tubb4b T C 2: 25,224,168 D41G probably benign Het
Uhrf1bp1l A T 10: 89,808,641 Q1181L probably benign Het
Usf3 T C 16: 44,220,005 M1616T possibly damaging Het
Vmn2r95 A T 17: 18,451,983 I733F possibly damaging Het
Zfp976 A T 7: 42,613,260 C385* probably null Het
Other mutations in Gja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Gja3 APN 14 57035679 missense probably damaging 1.00
R0470:Gja3 UTSW 14 57036427 missense probably damaging 1.00
R0631:Gja3 UTSW 14 57036762 missense possibly damaging 0.95
R1455:Gja3 UTSW 14 57036385 missense probably damaging 1.00
R1687:Gja3 UTSW 14 57036876 missense probably damaging 0.99
R2229:Gja3 UTSW 14 57036714 missense probably damaging 1.00
R3846:Gja3 UTSW 14 57035704 nonsense probably null
R5337:Gja3 UTSW 14 57035832 missense probably benign 0.22
R5797:Gja3 UTSW 14 57035713 missense probably damaging 0.98
R5940:Gja3 UTSW 14 57035860 missense probably damaging 0.99
Z1088:Gja3 UTSW 14 57035815 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TAGATGGCCAAGTCACCTGG -3'
(R):5'- TGTCCCACAGTACAGGCAAAG -3'

Sequencing Primer
(F):5'- AAGTCACCTGGTCTGGCAC -3'
(R):5'- CAAAGGCCATAGGGTTTCCTG -3'
Posted On2019-06-26