Incidental Mutation 'R7228:Zfp451'
ID562258
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7228 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33803394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000044372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000044455] [ENSMUST00000115167] [ENSMUST00000139143] [ENSMUST00000194656]
Predicted Effect probably benign
Transcript: ENSMUST00000019861
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000044455
AA Change: T136A
SMART Domains Protein: ENSMUSP00000044372
Gene: ENSMUSG00000042197
AA Change: T136A

DomainStartEndE-ValueType
low complexity region 92 98 N/A INTRINSIC
Pfam:LAP2alpha 344 499 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115167
SMART Domains Protein: ENSMUSP00000110821
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Predicted Effect probably benign
Transcript: ENSMUST00000194656
SMART Domains Protein: ENSMUSP00000141813
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 127 153 6.9e-2 SMART
ZnF_C2H2 170 190 5e-1 SMART
ZnF_C2H2 211 235 7.2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,291,656 D66G probably damaging Het
Abca13 T A 11: 9,297,653 F2467I probably benign Het
Acod1 A G 14: 103,049,329 T23A probably benign Het
Adam2 T A 14: 66,053,912 K306* probably null Het
Adcy10 A C 1: 165,510,272 I152L probably damaging Het
Amigo1 T C 3: 108,187,230 L15P probably benign Het
Aqp2 A G 15: 99,582,124 N156S probably benign Het
AU041133 A G 10: 82,151,271 K253E possibly damaging Het
Cacna1s A G 1: 136,071,059 T231A possibly damaging Het
Carf A T 1: 60,109,394 N83I probably damaging Het
Ccdc121 T C 1: 181,510,967 K140R probably benign Het
Cdc42bpb C T 12: 111,305,093 V1111M possibly damaging Het
Cep78 A G 19: 15,969,197 S424P probably benign Het
Cfap74 G A 4: 155,465,050 V123M unknown Het
Crot T A 5: 8,976,051 N312I probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Cyp4f39 A G 17: 32,491,829 D454G probably damaging Het
Dnaja4 A T 9: 54,714,285 H298L possibly damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Eif3j2 T C 18: 43,477,509 K80E probably damaging Het
Elp4 T A 2: 105,792,302 I351F probably damaging Het
Fbxw26 C G 9: 109,724,944 G209A possibly damaging Het
Fsip2 T A 2: 82,992,307 V6128D possibly damaging Het
Gli3 A G 13: 15,724,502 T825A probably benign Het
Gm2042 A G 12: 87,957,949 E60G probably benign Het
Gm26566 G T 4: 88,722,305 R111L unknown Het
Gm3138 C A 14: 4,252,444 H147Q probably damaging Het
Gm4858 T A 3: 93,073,686 C4S possibly damaging Het
Gucy1b1 T A 3: 82,033,274 N615I unknown Het
Ighv14-1 A T 12: 113,932,361 F8I not run Het
Kcnh8 C T 17: 52,956,716 T747I probably benign Het
Kctd1 T A 18: 15,062,412 S385C possibly damaging Het
Lmo7 T A 14: 101,896,535 M672K probably damaging Het
Lrrc69 T A 4: 14,775,027 K80N probably damaging Het
Map2k5 C T 9: 63,358,022 D75N probably damaging Het
Matr3 T C 18: 35,562,484 V4A unknown Het
Megf10 T C 18: 57,189,589 C69R probably damaging Het
Mettl1 A G 10: 127,045,283 E221G probably benign Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mlh3 A T 12: 85,235,656 L1401Q probably benign Het
Nacad T C 11: 6,598,412 I1412V probably benign Het
Nkain4 A T 2: 180,954,569 probably null Het
Notch2 T A 3: 98,137,317 C1518* probably null Het
Npw A G 17: 24,658,091 V112A probably benign Het
Olfr56 T A 11: 49,134,879 M229K possibly damaging Het
Olfr713 A T 7: 107,037,100 H315L probably benign Het
Pdzd2 T C 15: 12,372,973 T2359A probably benign Het
Pdzd2 T A 15: 12,458,145 K37* probably null Het
Phkb T G 8: 85,843,007 probably benign Het
Prrc2b C A 2: 32,214,306 Y1265* probably null Het
Rab31 T A 17: 65,717,553 M44L probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Rapgef2 T C 3: 79,069,218 D1279G probably benign Het
Rbm46 T C 3: 82,842,533 D468G probably benign Het
Ryr3 T C 2: 112,861,852 E1059G probably damaging Het
Sez6l2 T C 7: 126,953,725 L221P probably damaging Het
Slit3 T A 11: 35,599,418 V361E probably damaging Het
Soat1 G A 1: 156,434,238 S400F probably damaging Het
Spp1 T C 5: 104,440,445 S238P probably damaging Het
Tfap2c T C 2: 172,551,572 S136P probably benign Het
Tgfbr2 T C 9: 116,109,943 E297G probably damaging Het
Trim2 T C 3: 84,192,181 D228G probably benign Het
Wdr82 C A 9: 106,176,672 A74E probably benign Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 unclassified probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2225:Zfp451 UTSW 1 33770907 splice site probably benign
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4617:Zfp451 UTSW 1 33802671 intron probably benign
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R4964:Zfp451 UTSW 1 33777861 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense possibly damaging 0.96
R7082:Zfp451 UTSW 1 33772891 critical splice donor site probably null
R7123:Zfp451 UTSW 1 33776869 missense probably damaging 1.00
R7149:Zfp451 UTSW 1 33777324 missense probably damaging 1.00
R7179:Zfp451 UTSW 1 33802570 missense unknown
R7185:Zfp451 UTSW 1 33769893 missense probably damaging 1.00
R7402:Zfp451 UTSW 1 33813762 missense probably benign
R7462:Zfp451 UTSW 1 33777013 missense probably damaging 1.00
R7488:Zfp451 UTSW 1 33779140 missense probably benign 0.22
R7507:Zfp451 UTSW 1 33769759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGTATGACTCGGGACATC -3'
(R):5'- ATGCCTGAATCTAAAGTGCCATC -3'

Sequencing Primer
(F):5'- TATGACTCGGGACATCTCAGC -3'
(R):5'- TCGCCCAGAAATGTGCTCTAG -3'
Posted On2019-06-26