Incidental Mutation 'R7229:Prdx6'
ID562325
Institutional Source Beutler Lab
Gene Symbol Prdx6
Ensembl Gene ENSMUSG00000026701
Gene Nameperoxiredoxin 6
Synonyms1-cysPrx, Brp-12, NSGP, aiPLA2, CC26, Ltw4, Ltw-4, CP-3, Aop2, Lvtw-4, acidic calcium-independent phospholipase A2, 9430088D19Rik, GPx, 1-Cys Prx
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7229 (G1)
Quality Score210.009
Status Validated
Chromosome1
Chromosomal Location161240112-161251219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161247297 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 71 (L71H)
Ref Sequence ENSEMBL: ENSMUSP00000071636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051925] [ENSMUST00000071718] [ENSMUST00000192639]
Predicted Effect probably damaging
Transcript: ENSMUST00000051925
AA Change: L47H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050703
Gene: ENSMUSG00000026701
AA Change: L47H

DomainStartEndE-ValueType
Pfam:AhpC-TSA 3 122 1.8e-25 PFAM
Pfam:Redoxin 5 139 4.8e-9 PFAM
Pfam:1-cysPrx_C 142 181 6.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071718
AA Change: L71H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071636
Gene: ENSMUSG00000026701
AA Change: L71H

DomainStartEndE-ValueType
Pfam:Redoxin 6 162 1.3e-11 PFAM
Pfam:AhpC-TSA 7 146 3.4e-30 PFAM
Pfam:1-cysPrx_C 166 205 6.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192639
SMART Domains Protein: ENSMUSP00000142093
Gene: ENSMUSG00000026701

DomainStartEndE-ValueType
PDB:1PRX|B 1 43 6e-16 PDB
SCOP:d1prxa_ 5 39 9e-6 SMART
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes a member of the peroxiredoxin family of peroxidases. The encoded protein is a bifunctional enzyme that has glutathione peroxidase and phospholipase activities. This protein is an antioxidant that reduces peroxidized membrane phospholipids and plays an important role in phospholipid homeostasis based on its ability to generate lysophospholipid substrate for the remodeling pathway of phospholipid synthesis. Mice lacking this gene are sensitive to oxidant stress, have altered lung phospholipid metabolism and susceptible to skin tumorigenesis. Alternate splicing of this gene results in multiple transcript variants. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions of this gene show no macroscopic or microscopic abnormalities. However, they have an increased susceptibility to oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Prdx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0540:Prdx6 UTSW 1 161251103 missense probably damaging 1.00
R1479:Prdx6 UTSW 1 161244263 missense probably damaging 0.99
R3700:Prdx6 UTSW 1 161247288 missense probably damaging 1.00
R4930:Prdx6 UTSW 1 161241693 utr 3 prime probably benign
R5412:Prdx6 UTSW 1 161244290 missense probably damaging 0.99
R5577:Prdx6 UTSW 1 161243685 missense probably damaging 1.00
R6842:Prdx6 UTSW 1 161247370 missense probably damaging 1.00
R7450:Prdx6 UTSW 1 161241816 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTGGTTCTGTTCAAAGCTG -3'
(R):5'- TGGAGACAAGGTTGGAACTC -3'

Sequencing Primer
(F):5'- CTGTTCAAAGCTGTGGTCAATC -3'
(R):5'- CAAATACTGAGTTATTCTGCATGGTG -3'
Posted On2019-06-26