Incidental Mutation 'R7229:Fbxw7'
ID562335
Institutional Source Beutler Lab
Gene Symbol Fbxw7
Ensembl Gene ENSMUSG00000028086
Gene NameF-box and WD-40 domain protein 7
SynonymsFbw7, 1110001A17Rik, AGO, Cdc4, Fbxw6, SEL-10, Fbxo30
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location84815268-84979198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84977369 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 654 (L654S)
Ref Sequence ENSEMBL: ENSMUSP00000103306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029727] [ENSMUST00000107675] [ENSMUST00000107678] [ENSMUST00000107679] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000029727
AA Change: L573S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029727
Gene: ENSMUSG00000028086
AA Change: L573S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
FBOX 206 246 3.7e-8 SMART
WD40 291 329 3.14e-6 SMART
WD40 332 369 2.1e-7 SMART
WD40 372 409 7.55e-9 SMART
WD40 412 449 2.22e-6 SMART
WD40 452 489 1.07e-8 SMART
WD40 492 529 1.75e-4 SMART
WD40 532 572 2.32e-9 SMART
WD40 575 623 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107675
AA Change: L533S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103302
Gene: ENSMUSG00000028086
AA Change: L533S

DomainStartEndE-ValueType
low complexity region 99 106 N/A INTRINSIC
FBOX 166 206 3.7e-8 SMART
WD40 251 289 3.14e-6 SMART
WD40 292 329 2.1e-7 SMART
WD40 332 369 7.55e-9 SMART
WD40 372 409 2.22e-6 SMART
WD40 412 449 1.07e-8 SMART
WD40 452 489 1.75e-4 SMART
WD40 492 532 2.32e-9 SMART
WD40 535 583 2.37e2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107678
AA Change: L654S
SMART Domains Protein: ENSMUSP00000103305
Gene: ENSMUSG00000028086
AA Change: L654S

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107679
AA Change: L654S
SMART Domains Protein: ENSMUSP00000103306
Gene: ENSMUSG00000028086
AA Change: L654S

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this locus disrupts embryonic and extraembryonic vasculature, resulting in death by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Fbxw7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Fbxw7 APN 3 84969309 intron probably benign
IGL01468:Fbxw7 APN 3 84972499 missense probably benign 0.21
IGL01946:Fbxw7 APN 3 84904062 missense possibly damaging 0.60
IGL02248:Fbxw7 APN 3 84903633 missense possibly damaging 0.94
IGL02630:Fbxw7 APN 3 84965279 missense probably damaging 1.00
IGL02957:Fbxw7 APN 3 84976237 missense probably benign 0.00
PIT4453001:Fbxw7 UTSW 3 84965314 missense
R0043:Fbxw7 UTSW 3 84972567 intron probably benign
R0312:Fbxw7 UTSW 3 84967569 intron probably benign
R0595:Fbxw7 UTSW 3 84977367 intron probably null
R1664:Fbxw7 UTSW 3 84969171 missense possibly damaging 0.45
R1709:Fbxw7 UTSW 3 84976352 missense probably damaging 1.00
R1782:Fbxw7 UTSW 3 84903819 missense probably benign
R1974:Fbxw7 UTSW 3 84954935 missense possibly damaging 0.53
R2081:Fbxw7 UTSW 3 84974513 missense probably damaging 1.00
R2843:Fbxw7 UTSW 3 84976220 missense probably damaging 1.00
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3733:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R4333:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4335:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4581:Fbxw7 UTSW 3 84967545 missense probably benign 0.41
R4776:Fbxw7 UTSW 3 84925689 missense possibly damaging 0.53
R4799:Fbxw7 UTSW 3 84903861 nonsense probably null
R4822:Fbxw7 UTSW 3 84967507 missense possibly damaging 0.94
R5512:Fbxw7 UTSW 3 84954909 missense probably damaging 0.99
R5601:Fbxw7 UTSW 3 84976208 missense probably damaging 1.00
R5679:Fbxw7 UTSW 3 84977487 missense probably damaging 1.00
R6026:Fbxw7 UTSW 3 84952641 critical splice donor site probably null
R6182:Fbxw7 UTSW 3 84815771 critical splice donor site probably null
R6219:Fbxw7 UTSW 3 84969213 missense probably damaging 0.99
R6305:Fbxw7 UTSW 3 84976323 missense probably damaging 1.00
R6473:Fbxw7 UTSW 3 84952380 intron probably benign
R6823:Fbxw7 UTSW 3 84958627 missense probably benign 0.33
R6922:Fbxw7 UTSW 3 84972416 intron probably null
R7163:Fbxw7 UTSW 3 84925585 intron probably benign
R7554:Fbxw7 UTSW 3 84976313 missense
Predicted Primers PCR Primer
(F):5'- TGTAGAAGAGCACAAGTCCCAC -3'
(R):5'- AAGGGTAGGGAGTATATTGTCTACAC -3'

Sequencing Primer
(F):5'- CGCAGAAGCCCTGAACGTC -3'
(R):5'- GGAGTATATTGTCTACACAGTTGGAC -3'
Posted On2019-06-26