Incidental Mutation 'R7229:Elmod3'
ID562345
Institutional Source Beutler Lab
Gene Symbol Elmod3
Ensembl Gene ENSMUSG00000056698
Gene NameELMO/CED-12 domain containing 3
SynonymsELMOD3, RBM29, Rbed1, C330008I15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location72565922-72598413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72594753 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 14 (F14S)
Ref Sequence ENSEMBL: ENSMUSP00000067768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070597] [ENSMUST00000070990] [ENSMUST00000114069] [ENSMUST00000141833] [ENSMUST00000148108] [ENSMUST00000152705] [ENSMUST00000176168] [ENSMUST00000176364]
Predicted Effect probably benign
Transcript: ENSMUST00000070597
SMART Domains Protein: ENSMUSP00000068568
Gene: ENSMUSG00000056666

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:FAD_binding_2 68 113 8.9e-9 PFAM
Pfam:NAD_binding_8 71 136 1.3e-15 PFAM
Pfam:Amino_oxidase 76 587 2.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070990
AA Change: F14S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000067768
Gene: ENSMUSG00000056698
AA Change: F14S

DomainStartEndE-ValueType
Pfam:ELMO_CED12 151 314 3.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114069
AA Change: F14S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109703
Gene: ENSMUSG00000056698
AA Change: F14S

DomainStartEndE-ValueType
Pfam:ELMO_CED12 154 313 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141833
AA Change: F14S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000148108
Predicted Effect probably benign
Transcript: ENSMUST00000152705
AA Change: F14S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000176168
SMART Domains Protein: ENSMUSP00000135421
Gene: ENSMUSG00000056666

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1gpea1 95 175 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176364
SMART Domains Protein: ENSMUSP00000134847
Gene: ENSMUSG00000056666

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1d5ta1 91 290 7e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility family of GTPase-activating proteins that regulate Arf GTPase proteins. Members of this family are defined by a conserved engulfment and cell motility domain. In rat cochlea, the encoded protein is found in stereocilia, kinocilia and cuticular plate of developing hair cells suggesting a function for this protein in cochlear sensory cells. An allelic variant of this family has been associated with autosomal recessive nonsyndromic deafness-88 in humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Elmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Elmod3 APN 6 72586507 missense possibly damaging 0.66
IGL02725:Elmod3 APN 6 72594775 missense probably damaging 0.96
IGL03089:Elmod3 APN 6 72569316 missense probably damaging 1.00
R0092:Elmod3 UTSW 6 72566809 missense probably benign
R0173:Elmod3 UTSW 6 72577588 missense probably damaging 1.00
R0925:Elmod3 UTSW 6 72568938 missense probably damaging 1.00
R1602:Elmod3 UTSW 6 72569259 critical splice donor site probably null
R3147:Elmod3 UTSW 6 72586502 missense probably benign 0.01
R5594:Elmod3 UTSW 6 72594816 unclassified probably benign
R5870:Elmod3 UTSW 6 72594738 critical splice donor site probably null
R6045:Elmod3 UTSW 6 72568868 missense probably benign
R7173:Elmod3 UTSW 6 72577252 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCTGGAGATGGAACCCAC -3'
(R):5'- CATAGAAACCTCCTGCACCTTG -3'

Sequencing Primer
(F):5'- CAGCCAACGGTTGACTGCTG -3'
(R):5'- TTTCCTTGGAACCTGAATGACTG -3'
Posted On2019-06-26