Incidental Mutation 'R7229:Olfr701'
ID562353
Institutional Source Beutler Lab
Gene Symbol Olfr701
Ensembl Gene ENSMUSG00000036744
Gene Nameolfactory receptor 701
Synonyms4933433E02Rik, MOR283-1, GA_x6K02T2PBJ9-9195805-9196755, 4932441H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106814129-106821472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 106818995 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 304 (V304G)
Ref Sequence ENSEMBL: ENSMUSP00000074868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000080899] [ENSMUST00000166880] [ENSMUST00000217739] [ENSMUST00000219803]
Predicted Effect probably damaging
Transcript: ENSMUST00000075414
AA Change: V304G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744
AA Change: V304G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080899
SMART Domains Protein: ENSMUSP00000079704
Gene: ENSMUSG00000056863

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 300 2.9e-8 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166880
AA Change: V304G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130958
Gene: ENSMUSG00000036744
AA Change: V304G

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.8e-31 PFAM
Pfam:7tm_4 139 283 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217739
AA Change: V304G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000219803
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Olfr701
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr701 APN 7 106818620 missense probably damaging 1.00
IGL01972:Olfr701 APN 7 106818532 missense probably benign 0.01
IGL02541:Olfr701 APN 7 106818602 missense probably benign 0.34
R0276:Olfr701 UTSW 7 106818697 missense probably benign 0.00
R0345:Olfr701 UTSW 7 106818701 missense probably benign 0.38
R0467:Olfr701 UTSW 7 106818361 missense possibly damaging 0.49
R1829:Olfr701 UTSW 7 106819007 missense probably benign
R3116:Olfr701 UTSW 7 106818364 missense probably damaging 0.98
R3870:Olfr701 UTSW 7 106818840 nonsense probably null
R5267:Olfr701 UTSW 7 106818808 missense probably damaging 1.00
R6036:Olfr701 UTSW 7 106818460 missense probably damaging 1.00
R6036:Olfr701 UTSW 7 106818460 missense probably damaging 1.00
R7230:Olfr701 UTSW 7 106818179 missense possibly damaging 0.78
R7231:Olfr701 UTSW 7 106818443 missense probably damaging 1.00
R7419:Olfr701 UTSW 7 106818344 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTTCAAATGAGGGCAGGAAGA -3'
(R):5'- ACACCAACTACACAATAGAATATGTG -3'

Sequencing Primer
(F):5'- GAAGAAAGCCCTTGTCACCTGTTC -3'
(R):5'- TTGTTTAAAGAAGGAATAGTGAG -3'
Posted On2019-06-26