Incidental Mutation 'R7229:L3mbtl3'
ID562366
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26292662 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 598 (S598I)
Ref Sequence ENSEMBL: ENSMUSP00000101158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: S623I
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: S623I

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: S598I
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: S598I

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: S623I
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: S623I

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAAAGGCCTCATCCAAGTATG -3'
(R):5'- AATGGGAGTGCGCTTTTCTC -3'

Sequencing Primer
(F):5'- CATGTAGATCAGGTTGGCCTTATAC -3'
(R):5'- CTTCTTCCCATCGGTTAGTGGTG -3'
Posted On2019-06-26