Incidental Mutation 'R7229:Smarcc2'
ID562368
Institutional Source Beutler Lab
Gene Symbol Smarcc2
Ensembl Gene ENSMUSG00000025369
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms5930405J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128459248-128490482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128488048 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1085 (M1085K)
Ref Sequence ENSEMBL: ENSMUSP00000100868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026433] [ENSMUST00000099131] [ENSMUST00000105235] [ENSMUST00000164181] [ENSMUST00000217733] [ENSMUST00000217776] [ENSMUST00000217969] [ENSMUST00000218127] [ENSMUST00000218228] [ENSMUST00000219236] [ENSMUST00000220307] [ENSMUST00000220427]
Predicted Effect probably benign
Transcript: ENSMUST00000026433
SMART Domains Protein: ENSMUSP00000026433
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 4.9e-38 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
low complexity region 768 816 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
coiled coil region 906 921 N/A INTRINSIC
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1074 1098 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099131
SMART Domains Protein: ENSMUSP00000096734
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 3.9e-38 PFAM
SANT 628 676 9.04e-12 SMART
low complexity region 799 847 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 937 952 N/A INTRINSIC
low complexity region 979 1013 N/A INTRINSIC
low complexity region 1016 1041 N/A INTRINSIC
low complexity region 1043 1093 N/A INTRINSIC
low complexity region 1105 1129 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105235
AA Change: M1085K
SMART Domains Protein: ENSMUSP00000100868
Gene: ENSMUSG00000025369
AA Change: M1085K

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 426 512 4.5e-35 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
Pfam:SWIRM-assoc_3 684 750 4.1e-34 PFAM
low complexity region 768 816 N/A INTRINSIC
Pfam:SWIRM-assoc_1 863 946 1.5e-34 PFAM
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
low complexity region 1108 1123 N/A INTRINSIC
low complexity region 1153 1177 N/A INTRINSIC
low complexity region 1184 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164181
SMART Domains Protein: ENSMUSP00000128803
Gene: ENSMUSG00000090841

DomainStartEndE-ValueType
EFh 11 39 8.98e-4 SMART
EFh 88 116 3.64e1 SMART
EFh 123 151 6.63e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217733
Predicted Effect probably benign
Transcript: ENSMUST00000217776
Predicted Effect probably benign
Transcript: ENSMUST00000217969
Predicted Effect probably benign
Transcript: ENSMUST00000218127
Predicted Effect probably benign
Transcript: ENSMUST00000218228
Predicted Effect probably benign
Transcript: ENSMUST00000219236
Predicted Effect probably benign
Transcript: ENSMUST00000220307
Predicted Effect probably benign
Transcript: ENSMUST00000220427
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight increase in embryo weight at E13.5 and die shortly after birth (P0-P3). Mice homozygous for a conditional allele activated in the brain exhibit reduced cerebral cortical size and thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Smarcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Smarcc2 APN 10 128463055 missense probably damaging 0.97
IGL01450:Smarcc2 APN 10 128469320 missense probably damaging 1.00
IGL01638:Smarcc2 APN 10 128488074 unclassified probably benign
IGL01663:Smarcc2 APN 10 128488977 unclassified probably benign
IGL02308:Smarcc2 APN 10 128482772 missense probably damaging 1.00
IGL02511:Smarcc2 APN 10 128461382 missense probably damaging 1.00
IGL02633:Smarcc2 APN 10 128469687 missense probably damaging 1.00
IGL03375:Smarcc2 APN 10 128482912 missense probably damaging 0.99
IGL03493:Smarcc2 APN 10 128461357 missense probably damaging 1.00
PIT4403001:Smarcc2 UTSW 10 128463024 missense probably damaging 1.00
R0220:Smarcc2 UTSW 10 128483636 missense probably benign 0.32
R0281:Smarcc2 UTSW 10 128474722 missense probably benign 0.20
R1299:Smarcc2 UTSW 10 128461378 missense probably damaging 1.00
R1447:Smarcc2 UTSW 10 128469791 critical splice donor site probably null
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1498:Smarcc2 UTSW 10 128482192 missense probably benign 0.02
R1499:Smarcc2 UTSW 10 128463872 missense probably damaging 0.99
R1616:Smarcc2 UTSW 10 128482793 missense probably damaging 1.00
R1718:Smarcc2 UTSW 10 128468998 intron probably benign
R1767:Smarcc2 UTSW 10 128469082 missense possibly damaging 0.92
R1792:Smarcc2 UTSW 10 128463871 missense probably damaging 1.00
R1965:Smarcc2 UTSW 10 128474758 missense probably damaging 1.00
R2229:Smarcc2 UTSW 10 128488341 unclassified probably benign
R2286:Smarcc2 UTSW 10 128463743 missense possibly damaging 0.58
R2367:Smarcc2 UTSW 10 128482167 missense possibly damaging 0.86
R2398:Smarcc2 UTSW 10 128469682 missense possibly damaging 0.92
R3084:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3085:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3777:Smarcc2 UTSW 10 128482943 critical splice donor site probably null
R4346:Smarcc2 UTSW 10 128468823 missense probably benign 0.02
R4967:Smarcc2 UTSW 10 128483180 missense probably damaging 0.99
R4992:Smarcc2 UTSW 10 128474710 missense probably damaging 0.99
R5028:Smarcc2 UTSW 10 128461445 missense probably damaging 0.99
R5071:Smarcc2 UTSW 10 128463940 missense probably damaging 1.00
R5095:Smarcc2 UTSW 10 128469300 missense probably damaging 0.99
R5133:Smarcc2 UTSW 10 128461473 critical splice donor site probably null
R5180:Smarcc2 UTSW 10 128487362 unclassified probably benign
R5231:Smarcc2 UTSW 10 128461352 missense probably damaging 1.00
R5240:Smarcc2 UTSW 10 128481006 critical splice donor site probably null
R5401:Smarcc2 UTSW 10 128465504 missense probably damaging 1.00
R5445:Smarcc2 UTSW 10 128488074 unclassified probably benign
R5690:Smarcc2 UTSW 10 128484407 missense probably damaging 1.00
R5694:Smarcc2 UTSW 10 128484127 missense probably benign
R6240:Smarcc2 UTSW 10 128488024 unclassified probably benign
R6545:Smarcc2 UTSW 10 128484128 missense probably benign 0.00
R6713:Smarcc2 UTSW 10 128487769 intron probably null
R6934:Smarcc2 UTSW 10 128469672 missense probably benign 0.27
R7016:Smarcc2 UTSW 10 128485329 intron probably null
R7149:Smarcc2 UTSW 10 128482729 missense probably damaging 1.00
R7395:Smarcc2 UTSW 10 128485606 missense probably damaging 1.00
Z1088:Smarcc2 UTSW 10 128461434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTTATTCTAGTGCCAGGAG -3'
(R):5'- GATGTAGAGGGTTCGCCATG -3'

Sequencing Primer
(F):5'- CTTATTCTAGTGCCAGGAGAAAGG -3'
(R):5'- TAGAGGGTTCGCCATGGACAC -3'
Posted On2019-06-26