Incidental Mutation 'R0576:Ccr3'
ID56237
Institutional Source Beutler Lab
Gene Symbol Ccr3
Ensembl Gene ENSMUSG00000035448
Gene Namechemokine (C-C motif) receptor 3
SynonymsCC-CKR3, MIP-1 alphaRL2, Cmkbr3, CKR3
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0576 (G1)
Quality Score147
Status Validated
Chromosome9
Chromosomal Location124021972-124031689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124029009 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 127 (F127Y)
Ref Sequence ENSEMBL: ENSMUSP00000039107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039171]
Predicted Effect probably damaging
Transcript: ENSMUST00000039171
AA Change: F127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039107
Gene: ENSMUSG00000035448
AA Change: F127Y

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 49 320 7.9e-9 PFAM
Pfam:7tm_1 55 305 2.8e-52 PFAM
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in impaired eosinophil trafficking to the lungs and small intestine, and in increased bronchorestriction following methacholine challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Ccr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ccr3 APN 9 124029552 missense probably damaging 1.00
IGL03388:Ccr3 APN 9 124028621 splice site probably benign
PIT4810001:Ccr3 UTSW 9 124029608 missense probably benign 0.00
R0077:Ccr3 UTSW 9 124029024 missense probably damaging 1.00
R0118:Ccr3 UTSW 9 124029610 nonsense probably null
R0504:Ccr3 UTSW 9 124029441 missense possibly damaging 0.69
R0606:Ccr3 UTSW 9 124028802 missense probably benign 0.07
R2108:Ccr3 UTSW 9 124029299 missense possibly damaging 0.88
R3826:Ccr3 UTSW 9 124029677 missense possibly damaging 0.95
R4583:Ccr3 UTSW 9 124029440 missense probably benign 0.03
R4807:Ccr3 UTSW 9 124029297 missense probably damaging 1.00
R4823:Ccr3 UTSW 9 124028681 missense probably damaging 1.00
R4824:Ccr3 UTSW 9 124028772 missense probably damaging 1.00
R4932:Ccr3 UTSW 9 124029006 missense probably damaging 1.00
R5108:Ccr3 UTSW 9 124028931 missense probably benign 0.05
R5590:Ccr3 UTSW 9 124028793 missense probably damaging 1.00
R5610:Ccr3 UTSW 9 124029481 missense probably damaging 1.00
R5981:Ccr3 UTSW 9 124028783 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAACTTGGCAATTTCTGACCTGCTC -3'
(R):5'- CAATCACCTCAGTCACCTGCATGG -3'

Sequencing Primer
(F):5'- GCAATTTCTGACCTGCTCTTTCTC -3'
(R):5'- GGCCAGGTCCAGATGTTTACTC -3'
Posted On2013-07-11