Incidental Mutation 'R7229:Pafah1b1'
ID562373
Institutional Source Beutler Lab
Gene Symbol Pafah1b1
Ensembl Gene ENSMUSG00000020745
Gene Nameplatelet-activating factor acetylhydrolase, isoform 1b, subunit 1
SynonymsPafaha, lissencephaly-1 protein, Mdsh, PAF-AH 45, LIS-1, Lis1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74673949-74724670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74682278 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 320 (I320T)
Ref Sequence ENSEMBL: ENSMUSP00000021091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021091] [ENSMUST00000102520]
PDB Structure
N-TERMINAL DOMAIN OF LISSENCEPHALY-1 PROTEIN (LIS-1) [X-RAY DIFFRACTION]
PAF-AH HOLOENZYME: LIS1/ALFA2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021091
AA Change: I320T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021091
Gene: ENSMUSG00000020745
AA Change: I320T

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102520
AA Change: I320T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099578
Gene: ENSMUSG00000020745
AA Change: I320T

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mutations at this locus result in neuronal migration defects. Homozygous null mutants die around implantation. Different allelic combinations show variable cortical, hippocampal and olfactory disorganization and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Pafah1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pafah1b1 APN 11 74683647 missense probably damaging 1.00
IGL01861:Pafah1b1 APN 11 74690577 missense possibly damaging 0.81
IGL02082:Pafah1b1 APN 11 74699333 missense probably benign 0.33
IGL03180:Pafah1b1 APN 11 74683518 missense possibly damaging 0.80
hotspur UTSW 11 74682272 missense probably benign 0.02
picador UTSW 11 74677731 missense probably benign
R0362:Pafah1b1 UTSW 11 74683631 missense probably benign 0.01
R0462:Pafah1b1 UTSW 11 74677715 missense probably benign 0.00
R1962:Pafah1b1 UTSW 11 74699351 start gained probably benign
R3176:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3276:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3615:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R3616:Pafah1b1 UTSW 11 74690232 missense probably damaging 1.00
R4326:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4327:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4328:Pafah1b1 UTSW 11 74682240 missense probably benign 0.04
R4776:Pafah1b1 UTSW 11 74685871 unclassified probably benign
R4985:Pafah1b1 UTSW 11 74685988 missense probably damaging 1.00
R5128:Pafah1b1 UTSW 11 74679436 intron probably benign
R5148:Pafah1b1 UTSW 11 74684452 missense probably damaging 0.99
R6406:Pafah1b1 UTSW 11 74682272 missense probably benign 0.02
R6437:Pafah1b1 UTSW 11 74677731 missense probably benign
R7480:Pafah1b1 UTSW 11 74685914 missense probably damaging 1.00
X0064:Pafah1b1 UTSW 11 74689183 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCTTTCTCCTCCAGAGTAGC -3'
(R):5'- TTCTTTCTAGGCTAGGTACAGCTATC -3'

Sequencing Primer
(F):5'- CCAGCACTGACTGGTTTTTATAG -3'
(R):5'- GCAAGATTTCAAGTAAATGTCA -3'
Posted On2019-06-26