Incidental Mutation 'R7231:Zc3h3'
ID562499
Institutional Source Beutler Lab
Gene Symbol Zc3h3
Ensembl Gene ENSMUSG00000075600
Gene Namezinc finger CCCH type containing 3
SynonymsSmicl
Accession Numbers

Genbank: NM_172121.1; Ensembl: ENSMUST00000100538

Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R7231 (G1)
Quality Score198.009
Status Not validated
Chromosome15
Chromosomal Location75754430-75841915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75840382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 77 (V77M)
Ref Sequence ENSEMBL: ENSMUSP00000098106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100538]
Predicted Effect probably damaging
Transcript: ENSMUST00000100538
AA Change: V77M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098106
Gene: ENSMUSG00000075600
AA Change: V77M

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 370 388 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
ZnF_C3H1 663 689 1.03e-2 SMART
ZnF_C3H1 690 716 1.16e-1 SMART
ZnF_C3H1 718 743 5.38e-6 SMART
ZnF_C3H1 745 771 2.88e-6 SMART
ZnF_C3H1 772 794 1.64e-1 SMART
low complexity region 839 888 N/A INTRINSIC
low complexity region 895 905 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,294,175 T2013S probably benign Het
Ablim3 A G 18: 61,805,064 probably null Het
Acvrl1 T A 15: 101,136,223 C206* probably null Het
Adamts15 C A 9: 30,906,158 R541S probably damaging Het
Add3 A G 19: 53,233,146 I230V probably benign Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Asxl3 A T 18: 22,411,499 probably null Het
Asxl3 A G 18: 22,517,540 E862G probably damaging Het
Atp2b2 G A 6: 113,765,732 T798M possibly damaging Het
Car12 T C 9: 66,752,317 I208T probably damaging Het
Cgn T A 3: 94,773,192 Q600L probably damaging Het
Cgnl1 C T 9: 71,632,645 A1106T probably benign Het
Cmtr2 T C 8: 110,222,546 V496A probably benign Het
Cplx4 C A 18: 65,957,052 D99Y probably damaging Het
Cyfip2 T C 11: 46,224,136 T915A probably benign Het
Cyp4a32 T C 4: 115,609,697 L193P probably damaging Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Depdc5 C A 5: 32,901,865 Q303K possibly damaging Het
Dlx1 T A 2: 71,532,496 M249K possibly damaging Het
Dnah10 A T 5: 124,813,828 E3218V probably benign Het
Dnah9 T C 11: 65,965,647 D2896G probably damaging Het
Dtx4 C A 19: 12,469,658 G557* probably null Het
Eps8l2 A G 7: 141,360,392 N512D probably damaging Het
Fam20a T C 11: 109,721,375 D114G possibly damaging Het
Fli1 T C 9: 32,424,188 E316G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Haus8 G A 8: 71,253,137 T302I probably benign Het
Hmcn1 T C 1: 150,638,876 I3582V probably benign Het
Hnrnpul1 G A 7: 25,748,417 Q161* probably null Het
Hsf4 C T 8: 105,272,147 A223V probably damaging Het
Ighg2c A G 12: 113,288,016 W164R Het
Isl1 A G 13: 116,303,290 V174A probably benign Het
Itih4 A T 14: 30,896,614 I661F probably benign Het
Klhl14 A T 18: 21,652,136 L78Q probably damaging Het
L3mbtl3 T A 10: 26,339,282 I177F unknown Het
Lingo3 T A 10: 80,835,104 T331S possibly damaging Het
Lrrc36 T C 8: 105,461,057 V535A possibly damaging Het
Mapk8ip2 T G 15: 89,458,076 S497A probably benign Het
Mbip A G 12: 56,337,762 probably null Het
Nelfa C T 5: 33,898,825 G498D probably damaging Het
Nlrc5 T A 8: 94,521,805 probably null Het
Olfr1312 A T 2: 112,042,366 V222D probably damaging Het
Olfr679 T C 7: 105,085,787 S24P possibly damaging Het
Olfr701 A T 7: 106,818,443 Y120F probably damaging Het
Olfr863-ps1 T A 9: 19,941,559 T294S unknown Het
Pde2a A G 7: 101,505,953 Y567C probably damaging Het
Pdia4 A T 6: 47,800,957 F367Y probably benign Het
Pkdrej C A 15: 85,816,188 C1849F possibly damaging Het
Plekhj1 T G 10: 80,797,658 T52P probably damaging Het
Ppp2r5d A T 17: 46,684,060 Y572N probably benign Het
Prkcq T A 2: 11,290,451 Y570* probably null Het
Ptpn3 T A 4: 57,245,062 D226V probably damaging Het
Rab1b A G 19: 5,105,201 S22P probably damaging Het
Ralgapa1 A G 12: 55,604,191 S2060P probably damaging Het
Rnf148 G T 6: 23,654,891 S35R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd15 T A 12: 87,201,044 S168T possibly damaging Het
Slc26a4 T A 12: 31,547,946 N167I probably damaging Het
Slc39a1 C A 3: 90,251,790 H141Q probably benign Het
Slc9a3r2 C T 17: 24,650,104 R16H probably damaging Het
Snx21 T C 2: 164,786,201 S46P probably benign Het
Strip2 A G 6: 29,944,487 S657G probably damaging Het
Stxbp3 G A 3: 108,800,809 P392L probably damaging Het
Suclg1 G A 6: 73,263,971 R161H probably benign Het
Tas1r3 T C 4: 155,862,826 Y134C probably damaging Het
Tgif1 T A 17: 70,846,173 Q114L probably damaging Het
Tll2 A G 19: 41,086,234 F964L probably benign Het
Tmem181a T C 17: 6,297,920 S247P possibly damaging Het
Trav23 A T 14: 53,977,568 R79S probably damaging Het
Trf C A 9: 103,225,148 C177F probably damaging Het
Triml1 T C 8: 43,136,371 Y260C probably benign Het
Tulp4 T C 17: 6,236,235 F1513L probably benign Het
Umodl1 G A 17: 30,986,116 V562I probably damaging Het
Ush2a A G 1: 188,759,763 K3083R possibly damaging Het
Vmn1r74 A T 7: 11,846,961 I63F probably benign Het
Vmn2r38 C T 7: 9,097,638 C43Y possibly damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Vps13d A G 4: 145,057,462 V3914A Het
Vwa5b2 A G 16: 20,604,128 T984A probably benign Het
Zfp397 A T 18: 23,960,358 H300L probably damaging Het
Zfp950 G A 19: 61,119,212 R478C probably benign Het
Other mutations in Zc3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Zc3h3 APN 15 75779313 missense probably damaging 1.00
1mM(1):Zc3h3 UTSW 15 75840565 critical splice acceptor site probably null
R0477:Zc3h3 UTSW 15 75777083 missense possibly damaging 0.93
R0843:Zc3h3 UTSW 15 75837479 missense probably benign 0.00
R1891:Zc3h3 UTSW 15 75756931 missense possibly damaging 0.47
R1918:Zc3h3 UTSW 15 75777118 missense probably damaging 1.00
R2009:Zc3h3 UTSW 15 75779309 missense probably damaging 1.00
R2257:Zc3h3 UTSW 15 75839566 missense possibly damaging 0.77
R3853:Zc3h3 UTSW 15 75837497 missense probably benign 0.03
R5130:Zc3h3 UTSW 15 75779290 missense probably damaging 1.00
R5160:Zc3h3 UTSW 15 75809663 missense probably benign 0.02
R5164:Zc3h3 UTSW 15 75777026 missense probably benign 0.02
R5279:Zc3h3 UTSW 15 75839590 missense probably benign 0.08
R5622:Zc3h3 UTSW 15 75777079 missense probably damaging 1.00
R5743:Zc3h3 UTSW 15 75779531 nonsense probably null
R5923:Zc3h3 UTSW 15 75785564 missense probably damaging 0.99
R6294:Zc3h3 UTSW 15 75809568 missense possibly damaging 0.90
R6377:Zc3h3 UTSW 15 75839455 missense probably damaging 0.99
R6735:Zc3h3 UTSW 15 75756634 missense probably benign 0.00
R7043:Zc3h3 UTSW 15 75809636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCATTGATGGCACCTG -3'
(R):5'- TAACTGAGCGTGTGATTCTGC -3'

Sequencing Primer
(F):5'- AAGCATTGATGGCACCTGACTTTG -3'
(R):5'- GCCTTCTCAGGTCTAATTGATGAC -3'
Posted On2019-06-26