Incidental Mutation 'R7231:Slc9a3r2'
ID562506
Institutional Source Beutler Lab
Gene Symbol Slc9a3r2
Ensembl Gene ENSMUSG00000002504
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2
SynonymsSip1, 0610011L07Rik, Sryip1, Nherf2, Octs2, Tka-1, Sip-1, E3karp, 2010007A20Rik, 1200011K07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7231 (G1)
Quality Score143.008
Status Not validated
Chromosome17
Chromosomal Location24639282-24650305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24650104 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 16 (R16H)
Ref Sequence ENSEMBL: ENSMUSP00000002572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002572]
Predicted Effect probably damaging
Transcript: ENSMUST00000002572
AA Change: R16H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002572
Gene: ENSMUSG00000002504
AA Change: R16H

DomainStartEndE-ValueType
PDZ 19 91 6.31e-21 SMART
PDZ 159 231 8.79e-20 SMART
Pfam:EBP50_C 232 284 5.1e-13 PFAM
Pfam:EBP50_C 261 337 2.3e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal and display normal cAMP- and cGMP-activated CFTR transepithelial chloride transport and bicarbonate secretion in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,294,175 T2013S probably benign Het
Ablim3 A G 18: 61,805,064 probably null Het
Acvrl1 T A 15: 101,136,223 C206* probably null Het
Adamts15 C A 9: 30,906,158 R541S probably damaging Het
Add3 A G 19: 53,233,146 I230V probably benign Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Asxl3 A T 18: 22,411,499 probably null Het
Asxl3 A G 18: 22,517,540 E862G probably damaging Het
Atp2b2 G A 6: 113,765,732 T798M possibly damaging Het
Car12 T C 9: 66,752,317 I208T probably damaging Het
Cgn T A 3: 94,773,192 Q600L probably damaging Het
Cgnl1 C T 9: 71,632,645 A1106T probably benign Het
Cmtr2 T C 8: 110,222,546 V496A probably benign Het
Cplx4 C A 18: 65,957,052 D99Y probably damaging Het
Cyfip2 T C 11: 46,224,136 T915A probably benign Het
Cyp4a32 T C 4: 115,609,697 L193P probably damaging Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Depdc5 C A 5: 32,901,865 Q303K possibly damaging Het
Dlx1 T A 2: 71,532,496 M249K possibly damaging Het
Dnah10 A T 5: 124,813,828 E3218V probably benign Het
Dnah9 T C 11: 65,965,647 D2896G probably damaging Het
Dtx4 C A 19: 12,469,658 G557* probably null Het
Eps8l2 A G 7: 141,360,392 N512D probably damaging Het
Fam20a T C 11: 109,721,375 D114G possibly damaging Het
Fli1 T C 9: 32,424,188 E316G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Haus8 G A 8: 71,253,137 T302I probably benign Het
Hmcn1 T C 1: 150,638,876 I3582V probably benign Het
Hnrnpul1 G A 7: 25,748,417 Q161* probably null Het
Hsf4 C T 8: 105,272,147 A223V probably damaging Het
Ighg2c A G 12: 113,288,016 W164R Het
Isl1 A G 13: 116,303,290 V174A probably benign Het
Itih4 A T 14: 30,896,614 I661F probably benign Het
Klhl14 A T 18: 21,652,136 L78Q probably damaging Het
L3mbtl3 T A 10: 26,339,282 I177F unknown Het
Lingo3 T A 10: 80,835,104 T331S possibly damaging Het
Lrrc36 T C 8: 105,461,057 V535A possibly damaging Het
Mapk8ip2 T G 15: 89,458,076 S497A probably benign Het
Mbip A G 12: 56,337,762 probably null Het
Nelfa C T 5: 33,898,825 G498D probably damaging Het
Nlrc5 T A 8: 94,521,805 probably null Het
Olfr1312 A T 2: 112,042,366 V222D probably damaging Het
Olfr679 T C 7: 105,085,787 S24P possibly damaging Het
Olfr701 A T 7: 106,818,443 Y120F probably damaging Het
Olfr863-ps1 T A 9: 19,941,559 T294S unknown Het
Pde2a A G 7: 101,505,953 Y567C probably damaging Het
Pdia4 A T 6: 47,800,957 F367Y probably benign Het
Pkdrej C A 15: 85,816,188 C1849F possibly damaging Het
Plekhj1 T G 10: 80,797,658 T52P probably damaging Het
Ppp2r5d A T 17: 46,684,060 Y572N probably benign Het
Prkcq T A 2: 11,290,451 Y570* probably null Het
Ptpn3 T A 4: 57,245,062 D226V probably damaging Het
Rab1b A G 19: 5,105,201 S22P probably damaging Het
Ralgapa1 A G 12: 55,604,191 S2060P probably damaging Het
Rnf148 G T 6: 23,654,891 S35R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd15 T A 12: 87,201,044 S168T possibly damaging Het
Slc26a4 T A 12: 31,547,946 N167I probably damaging Het
Slc39a1 C A 3: 90,251,790 H141Q probably benign Het
Snx21 T C 2: 164,786,201 S46P probably benign Het
Strip2 A G 6: 29,944,487 S657G probably damaging Het
Stxbp3 G A 3: 108,800,809 P392L probably damaging Het
Suclg1 G A 6: 73,263,971 R161H probably benign Het
Tas1r3 T C 4: 155,862,826 Y134C probably damaging Het
Tgif1 T A 17: 70,846,173 Q114L probably damaging Het
Tll2 A G 19: 41,086,234 F964L probably benign Het
Tmem181a T C 17: 6,297,920 S247P possibly damaging Het
Trav23 A T 14: 53,977,568 R79S probably damaging Het
Trf C A 9: 103,225,148 C177F probably damaging Het
Triml1 T C 8: 43,136,371 Y260C probably benign Het
Tulp4 T C 17: 6,236,235 F1513L probably benign Het
Umodl1 G A 17: 30,986,116 V562I probably damaging Het
Ush2a A G 1: 188,759,763 K3083R possibly damaging Het
Vmn1r74 A T 7: 11,846,961 I63F probably benign Het
Vmn2r38 C T 7: 9,097,638 C43Y possibly damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Vps13d A G 4: 145,057,462 V3914A Het
Vwa5b2 A G 16: 20,604,128 T984A probably benign Het
Zc3h3 C T 15: 75,840,382 V77M probably damaging Het
Zfp397 A T 18: 23,960,358 H300L probably damaging Het
Zfp950 G A 19: 61,119,212 R478C probably benign Het
Other mutations in Slc9a3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02676:Slc9a3r2 APN 17 24641956 missense probably damaging 1.00
R1843:Slc9a3r2 UTSW 17 24641719 missense possibly damaging 0.75
R2199:Slc9a3r2 UTSW 17 24640596 missense probably null 0.37
R2912:Slc9a3r2 UTSW 17 24642241 missense probably damaging 1.00
R4774:Slc9a3r2 UTSW 17 24644899 start codon destroyed probably null 0.01
R5352:Slc9a3r2 UTSW 17 24642255 missense probably damaging 1.00
R5356:Slc9a3r2 UTSW 17 24641971 missense probably damaging 1.00
R5562:Slc9a3r2 UTSW 17 24641824 missense probably benign 0.06
R5841:Slc9a3r2 UTSW 17 24644877 missense probably benign
R7338:Slc9a3r2 UTSW 17 24650208 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTGTGCAGGACTGAGCTTCC -3'
(R):5'- AAGCAATCCCACTCCTTGG -3'

Sequencing Primer
(F):5'- AGGACTGAGCTTCCTCACCAG -3'
(R):5'- CCACTCCTTGGTCCTAGGG -3'
Posted On2019-06-26