Incidental Mutation 'R7231:Asxl3'
ID562512
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R7231 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 22411499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect probably null
Transcript: ENSMUST00000097655
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120223
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,294,175 T2013S probably benign Het
Ablim3 A G 18: 61,805,064 probably null Het
Acvrl1 T A 15: 101,136,223 C206* probably null Het
Adamts15 C A 9: 30,906,158 R541S probably damaging Het
Add3 A G 19: 53,233,146 I230V probably benign Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Atp2b2 G A 6: 113,765,732 T798M possibly damaging Het
Car12 T C 9: 66,752,317 I208T probably damaging Het
Cgn T A 3: 94,773,192 Q600L probably damaging Het
Cgnl1 C T 9: 71,632,645 A1106T probably benign Het
Cmtr2 T C 8: 110,222,546 V496A probably benign Het
Cplx4 C A 18: 65,957,052 D99Y probably damaging Het
Cyfip2 T C 11: 46,224,136 T915A probably benign Het
Cyp4a32 T C 4: 115,609,697 L193P probably damaging Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Depdc5 C A 5: 32,901,865 Q303K possibly damaging Het
Dlx1 T A 2: 71,532,496 M249K possibly damaging Het
Dnah10 A T 5: 124,813,828 E3218V probably benign Het
Dnah9 T C 11: 65,965,647 D2896G probably damaging Het
Dtx4 C A 19: 12,469,658 G557* probably null Het
Eps8l2 A G 7: 141,360,392 N512D probably damaging Het
Fam20a T C 11: 109,721,375 D114G possibly damaging Het
Fli1 T C 9: 32,424,188 E316G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Haus8 G A 8: 71,253,137 T302I probably benign Het
Hmcn1 T C 1: 150,638,876 I3582V probably benign Het
Hnrnpul1 G A 7: 25,748,417 Q161* probably null Het
Hsf4 C T 8: 105,272,147 A223V probably damaging Het
Ighg2c A G 12: 113,288,016 W164R Het
Isl1 A G 13: 116,303,290 V174A probably benign Het
Itih4 A T 14: 30,896,614 I661F probably benign Het
Klhl14 A T 18: 21,652,136 L78Q probably damaging Het
L3mbtl3 T A 10: 26,339,282 I177F unknown Het
Lingo3 T A 10: 80,835,104 T331S possibly damaging Het
Lrrc36 T C 8: 105,461,057 V535A possibly damaging Het
Mapk8ip2 T G 15: 89,458,076 S497A probably benign Het
Mbip A G 12: 56,337,762 probably null Het
Nelfa C T 5: 33,898,825 G498D probably damaging Het
Nlrc5 T A 8: 94,521,805 probably null Het
Olfr1312 A T 2: 112,042,366 V222D probably damaging Het
Olfr679 T C 7: 105,085,787 S24P possibly damaging Het
Olfr701 A T 7: 106,818,443 Y120F probably damaging Het
Olfr863-ps1 T A 9: 19,941,559 T294S unknown Het
Pde2a A G 7: 101,505,953 Y567C probably damaging Het
Pdia4 A T 6: 47,800,957 F367Y probably benign Het
Pkdrej C A 15: 85,816,188 C1849F possibly damaging Het
Plekhj1 T G 10: 80,797,658 T52P probably damaging Het
Ppp2r5d A T 17: 46,684,060 Y572N probably benign Het
Prkcq T A 2: 11,290,451 Y570* probably null Het
Ptpn3 T A 4: 57,245,062 D226V probably damaging Het
Rab1b A G 19: 5,105,201 S22P probably damaging Het
Ralgapa1 A G 12: 55,604,191 S2060P probably damaging Het
Rnf148 G T 6: 23,654,891 S35R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd15 T A 12: 87,201,044 S168T possibly damaging Het
Slc26a4 T A 12: 31,547,946 N167I probably damaging Het
Slc39a1 C A 3: 90,251,790 H141Q probably benign Het
Slc9a3r2 C T 17: 24,650,104 R16H probably damaging Het
Snx21 T C 2: 164,786,201 S46P probably benign Het
Strip2 A G 6: 29,944,487 S657G probably damaging Het
Stxbp3 G A 3: 108,800,809 P392L probably damaging Het
Suclg1 G A 6: 73,263,971 R161H probably benign Het
Tas1r3 T C 4: 155,862,826 Y134C probably damaging Het
Tgif1 T A 17: 70,846,173 Q114L probably damaging Het
Tll2 A G 19: 41,086,234 F964L probably benign Het
Tmem181a T C 17: 6,297,920 S247P possibly damaging Het
Trav23 A T 14: 53,977,568 R79S probably damaging Het
Trf C A 9: 103,225,148 C177F probably damaging Het
Triml1 T C 8: 43,136,371 Y260C probably benign Het
Tulp4 T C 17: 6,236,235 F1513L probably benign Het
Umodl1 G A 17: 30,986,116 V562I probably damaging Het
Ush2a A G 1: 188,759,763 K3083R possibly damaging Het
Vmn1r74 A T 7: 11,846,961 I63F probably benign Het
Vmn2r38 C T 7: 9,097,638 C43Y possibly damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Vps13d A G 4: 145,057,462 V3914A Het
Vwa5b2 A G 16: 20,604,128 T984A probably benign Het
Zc3h3 C T 15: 75,840,382 V77M probably damaging Het
Zfp397 A T 18: 23,960,358 H300L probably damaging Het
Zfp950 G A 19: 61,119,212 R478C probably benign Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0519:Asxl3 UTSW 18 22523520 missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22522986 missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R2907:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22524233 missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22523115 missense probably benign 0.45
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R5873:Asxl3 UTSW 18 22516085 missense probably benign 0.04
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7058:Asxl3 UTSW 18 22517674 missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTTACCACAGTGACGGTG -3'
(R):5'- ACAGCAGAGTAAACCAAGTAGTATC -3'

Sequencing Primer
(F):5'- CCACAGTGACGGTGGTTTTTC -3'
(R):5'- CTGGAGTCAGGTACACTC -3'
Posted On2019-06-26