Incidental Mutation 'R7232:Tlr5'
ID562525
Institutional Source Beutler Lab
Gene Symbol Tlr5
Ensembl Gene ENSMUSG00000079164
Gene Nametoll-like receptor 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7232 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location182954788-182976044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 182973499 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 123 (E123K)
Ref Sequence ENSEMBL: ENSMUSP00000141318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]
Predicted Effect probably benign
Transcript: ENSMUST00000110997
AA Change: E123K

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: E123K

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 3.11e-2 SMART
LRR 159 183 5.56e0 SMART
LRR 184 207 1.97e2 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 7.05e-1 SMART
LRR 350 373 2.92e1 SMART
LRR 374 397 2.54e1 SMART
LRR 398 418 1.29e2 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 1.06e-4 SMART
LRR 540 563 6.13e-1 SMART
LRR 564 585 2.21e2 SMART
LRRCT 594 645 7.01e-6 SMART
low complexity region 657 676 N/A INTRINSIC
TIR 707 852 3.89e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191820
AA Change: E109K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: E109K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
LRR_TYP 95 118 1.3e-4 SMART
LRR 145 169 2.3e-2 SMART
LRR 170 193 8.2e-1 SMART
low complexity region 248 261 N/A INTRINSIC
LRR 312 335 2.9e-3 SMART
LRR 336 359 1.2e-1 SMART
LRR 360 383 1.1e-1 SMART
LRR 384 404 5.4e-1 SMART
low complexity region 427 442 N/A INTRINSIC
LRR_TYP 502 525 4.5e-7 SMART
LRR 526 549 2.5e-3 SMART
LRR 550 571 9.4e-1 SMART
LRRCT 580 631 3.4e-8 SMART
transmembrane domain 642 664 N/A INTRINSIC
TIR 693 838 2.5e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193539
Predicted Effect probably benign
Transcript: ENSMUST00000193687
AA Change: E123K

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: E123K

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 1.3e-4 SMART
LRR 159 183 2.3e-2 SMART
LRR 184 207 8.2e-1 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 2.9e-3 SMART
LRR 350 373 1.2e-1 SMART
LRR 374 397 1.1e-1 SMART
LRR 398 418 5.4e-1 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 4.5e-7 SMART
LRR 540 563 2.5e-3 SMART
LRR 564 585 9.4e-1 SMART
LRRCT 594 645 3.4e-8 SMART
transmembrane domain 656 678 N/A INTRINSIC
TIR 707 852 2.5e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195614
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,631 S41T possibly damaging Het
4930433I11Rik G A 7: 40,993,179 G91S probably damaging Het
Adam21 T G 12: 81,560,556 N144T probably damaging Het
Angpt4 T C 2: 151,929,540 S259P possibly damaging Het
Aqr A C 2: 114,105,882 L1320R probably damaging Het
Arhgef10 G A 8: 14,940,323 G266D probably benign Het
Bop1 A G 15: 76,453,346 V693A probably damaging Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc5l A G 17: 45,427,937 probably null Het
Cfap46 C A 7: 139,617,577 R2126L unknown Het
Chek2 T C 5: 110,860,915 V304A probably damaging Het
Ctps C A 4: 120,548,124 G374C probably damaging Het
Defa27 A T 8: 21,315,609 I22F probably damaging Het
Dnah14 T C 1: 181,757,363 S3220P probably damaging Het
Dopey2 T G 16: 93,760,485 probably null Het
Dpysl5 G A 5: 30,792,298 V471I probably benign Het
Duoxa1 T A 2: 122,305,247 I124F probably damaging Het
Eif4enif1 A G 11: 3,215,678 E85G possibly damaging Het
Eogt T A 6: 97,119,983 I355F probably damaging Het
Epha7 T A 4: 28,951,279 V800E probably damaging Het
Evi5l A G 8: 4,205,906 Q633R possibly damaging Het
Fam170a T C 18: 50,281,661 Y125H probably damaging Het
Fbxo15 T C 18: 84,962,622 Y241H probably damaging Het
Gbe1 T C 16: 70,436,940 I235T possibly damaging Het
Gfra3 C T 18: 34,711,181 R102Q probably damaging Het
Gjd4 C T 18: 9,280,380 G233S probably damaging Het
Gm29106 C T 1: 118,199,561 P328S probably damaging Het
Hgfac G T 5: 35,046,914 R507L probably damaging Het
Jakmip3 A G 7: 139,007,626 K153R probably benign Het
Kcnc1 T A 7: 46,427,959 V395E probably damaging Het
Krt6b T C 15: 101,678,142 D304G probably damaging Het
Ldha T C 7: 46,850,899 Y174H probably benign Het
Lgi4 G A 7: 31,067,351 V268M possibly damaging Het
Lpar3 T G 3: 146,241,306 probably null Het
Lrp3 T C 7: 35,206,052 D103G probably damaging Het
March5 G A 19: 37,217,314 probably null Het
Muc5b A T 7: 141,866,129 H4115L possibly damaging Het
Myh13 G A 11: 67,348,846 D741N probably damaging Het
Naglu A T 11: 101,076,426 I401F probably damaging Het
Ncam2 T A 16: 81,512,871 N416K probably damaging Het
Ncan A G 8: 70,112,088 L292S probably damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Olfr714 T A 7: 107,073,855 I9K probably benign Het
Onecut2 T A 18: 64,341,562 W395R probably damaging Het
Pak6 T A 2: 118,693,522 V386E probably damaging Het
Pias2 A G 18: 77,133,235 S396G probably benign Het
Plxna2 T A 1: 194,712,260 L483H probably damaging Het
Prss36 G T 7: 127,935,591 R484S probably benign Het
Ptpn21 A T 12: 98,688,737 V657E probably benign Het
Rassf2 T C 2: 131,996,412 E318G probably damaging Het
Rp1 A C 1: 4,228,601 S623A unknown Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn11a T A 9: 119,759,916 E1308V probably damaging Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Slit3 A G 11: 35,610,689 T417A possibly damaging Het
Sostdc1 C A 12: 36,317,311 A162E possibly damaging Het
Sox8 G T 17: 25,567,540 S396R probably benign Het
Sult2a3 A T 7: 14,082,760 F164L possibly damaging Het
Susd2 T C 10: 75,639,851 Y438C probably damaging Het
Tas2r106 T G 6: 131,678,847 T14P probably damaging Het
Tenm3 G A 8: 48,235,935 R2206W probably damaging Het
Ticrr A T 7: 79,693,742 K1118N probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
U2surp A G 9: 95,493,717 V141A probably benign Het
Unc79 T A 12: 103,134,475 S2050T possibly damaging Het
Usp13 A G 3: 32,865,871 D235G probably benign Het
Vcam1 T C 3: 116,125,979 T213A possibly damaging Het
Vmn2r60 T A 7: 42,136,742 I323N possibly damaging Het
Vps13b A G 15: 35,877,557 I2892M probably damaging Het
Wnt5a T A 14: 28,518,372 S160T probably benign Het
Zar1 G A 5: 72,580,951 P36L possibly damaging Het
Zfp773 A T 7: 7,132,985 M204K probably benign Het
Zhx1 T C 15: 58,053,069 T594A probably benign Het
Other mutations in Tlr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tlr5 APN 1 182973829 missense probably benign
IGL00940:Tlr5 APN 1 182974196 missense possibly damaging 0.84
IGL01302:Tlr5 APN 1 182974748 missense probably benign 0.00
IGL01480:Tlr5 APN 1 182973499 missense probably benign 0.09
IGL01717:Tlr5 APN 1 182975398 missense probably damaging 1.00
IGL01896:Tlr5 APN 1 182974879 missense possibly damaging 0.64
IGL02083:Tlr5 APN 1 182973884 missense possibly damaging 0.91
IGL02135:Tlr5 APN 1 182973254 missense possibly damaging 0.82
R0464:Tlr5 UTSW 1 182973710 missense probably benign 0.01
R0552:Tlr5 UTSW 1 182975696 unclassified probably null
R0556:Tlr5 UTSW 1 182974151 missense probably damaging 1.00
R0639:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R0670:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R1014:Tlr5 UTSW 1 182975677 missense probably benign 0.00
R1125:Tlr5 UTSW 1 182973892 missense probably benign 0.00
R1563:Tlr5 UTSW 1 182975010 missense probably benign 0.09
R1775:Tlr5 UTSW 1 182973722 missense probably damaging 0.99
R1793:Tlr5 UTSW 1 182972447 missense probably benign 0.00
R1991:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R1992:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R2114:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2116:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2225:Tlr5 UTSW 1 182972376 start gained probably benign
R2265:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2266:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2268:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2882:Tlr5 UTSW 1 182973893 missense probably damaging 1.00
R3695:Tlr5 UTSW 1 182975347 missense probably damaging 1.00
R3747:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R3749:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R4084:Tlr5 UTSW 1 182974848 missense possibly damaging 0.60
R4794:Tlr5 UTSW 1 182973896 missense probably benign 0.00
R4895:Tlr5 UTSW 1 182974199 missense probably damaging 1.00
R4964:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R4966:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R5496:Tlr5 UTSW 1 182973632 missense probably damaging 1.00
R6056:Tlr5 UTSW 1 182974038 missense possibly damaging 0.76
R6715:Tlr5 UTSW 1 182972659 intron probably benign
R6825:Tlr5 UTSW 1 182973044 intron probably benign
R6961:Tlr5 UTSW 1 182973511 nonsense probably null
R7135:Tlr5 UTSW 1 182975523 missense possibly damaging 0.87
R7255:Tlr5 UTSW 1 182974316 missense probably damaging 1.00
R7257:Tlr5 UTSW 1 182974233 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGTAACCTCACCCAGATTCC -3'
(R):5'- CAGTTCCCGGAATGAAGAATGG -3'

Sequencing Primer
(F):5'- TACTACCACTGAGAGGCTCCTG -3'
(R):5'- CCGGAATGAAGAATGGAGGCG -3'
Posted On2019-06-26