Incidental Mutation 'R7234:Gbp5'
ID562682
Institutional Source Beutler Lab
Gene Symbol Gbp5
Ensembl Gene ENSMUSG00000105504
Gene Nameguanylate binding protein 5
Synonyms5330409J06Rik, Gbp5a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location142493978-142522344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142521137 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 583 (H583L)
Ref Sequence ENSEMBL: ENSMUSP00000087587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090127] [ENSMUST00000196255] [ENSMUST00000197459]
Predicted Effect probably benign
Transcript: ENSMUST00000090127
AA Change: H583L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000087587
Gene: ENSMUSG00000105504
AA Change: H583L

DomainStartEndE-ValueType
Pfam:GBP 18 281 4e-113 PFAM
Pfam:GBP_C 283 575 6e-109 PFAM
low complexity region 579 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196255
SMART Domains Protein: ENSMUSP00000143336
Gene: ENSMUSG00000105504

DomainStartEndE-ValueType
Pfam:GBP 18 281 2.8e-113 PFAM
Pfam:GBP_C 283 556 5.5e-106 PFAM
internal_repeat_1 579 640 3.01e-21 PROSPERO
internal_repeat_1 647 708 3.01e-21 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000197459
SMART Domains Protein: ENSMUSP00000142938
Gene: ENSMUSG00000105504

DomainStartEndE-ValueType
Pfam:GBP 18 65 4.7e-16 PFAM
Pfam:GBP 63 169 4.8e-33 PFAM
Pfam:GBP_C 171 444 9.3e-104 PFAM
internal_repeat_1 467 528 5.89e-22 PROSPERO
internal_repeat_1 535 596 5.89e-22 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The encoded protein acts as an activator of NLRP3 inflammasome assembly and has a role in innate immunity and inflammation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Listeria infection and NLRP3 inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Gbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Gbp5 APN 3 142500594 missense probably damaging 1.00
IGL01625:Gbp5 APN 3 142503028 missense probably damaging 0.98
IGL02294:Gbp5 APN 3 142503827 missense probably damaging 1.00
PIT4362001:Gbp5 UTSW 3 142500710 missense probably damaging 1.00
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0166:Gbp5 UTSW 3 142506919 critical splice donor site probably null
R0357:Gbp5 UTSW 3 142505411 missense probably benign 0.05
R0414:Gbp5 UTSW 3 142507913 critical splice acceptor site probably null
R0457:Gbp5 UTSW 3 142507757 missense probably damaging 1.00
R0959:Gbp5 UTSW 3 142503124 missense possibly damaging 0.47
R1520:Gbp5 UTSW 3 142508014 missense probably damaging 0.97
R2143:Gbp5 UTSW 3 142503832 missense probably damaging 1.00
R2369:Gbp5 UTSW 3 142500719 missense possibly damaging 0.54
R3155:Gbp5 UTSW 3 142503127 critical splice donor site probably null
R4602:Gbp5 UTSW 3 142503785 missense probably benign 0.06
R4770:Gbp5 UTSW 3 142508076 missense possibly damaging 0.75
R5096:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R5605:Gbp5 UTSW 3 142501276 missense probably damaging 1.00
R7066:Gbp5 UTSW 3 142507729 missense probably benign 0.00
R7237:Gbp5 UTSW 3 142507700 missense probably benign 0.41
R7258:Gbp5 UTSW 3 142506781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTTGTCTTCCTTACAATAG -3'
(R):5'- TGTGGCCAAGTTCTACTCCAC -3'

Sequencing Primer
(F):5'- TGGTTTAGGAATAAGACCAGAGTTTG -3'
(R):5'- CCCCGAGTAACATAAAATATCTTGAG -3'
Posted On2019-06-26