Incidental Mutation 'R7234:Gsap'
ID562690
Institutional Source Beutler Lab
Gene Symbol Gsap
Ensembl Gene ENSMUSG00000039934
Gene Namegamma-secretase activating protein
SynonymsA530088I07Rik, Pion
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location21186255-21315132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21186435 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000043679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198071] [ENSMUST00000198937]
Predicted Effect probably benign
Transcript: ENSMUST00000036031
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: T25A

DomainStartEndE-ValueType
low complexity region 386 398 N/A INTRINSIC
Pfam:GSAP-16 646 753 6.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195969
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000198014
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000198071
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000198937
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: T25A

DomainStartEndE-ValueType
low complexity region 355 367 N/A INTRINSIC
Pfam:GSAP-16 608 722 1.6e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Gsap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Gsap APN 5 21221305 splice site probably benign
IGL00788:Gsap APN 5 21254024 missense probably damaging 0.96
IGL01344:Gsap APN 5 21242883 critical splice donor site probably null
IGL01347:Gsap APN 5 21226320 missense probably benign 0.08
IGL01618:Gsap APN 5 21226248 missense probably damaging 1.00
IGL01730:Gsap APN 5 21290154 unclassified probably benign
IGL02061:Gsap APN 5 21281611 splice site probably benign
IGL02161:Gsap APN 5 21253379 missense probably damaging 1.00
IGL02259:Gsap APN 5 21186400 missense probably benign 0.01
IGL02635:Gsap APN 5 21289816 missense probably damaging 1.00
IGL02684:Gsap APN 5 21242803 critical splice acceptor site probably null
IGL02822:Gsap APN 5 21217444 missense probably damaging 1.00
IGL03231:Gsap APN 5 21229166 missense probably damaging 0.99
PIT4305001:Gsap UTSW 5 21186409 missense probably damaging 0.98
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0045:Gsap UTSW 5 21226832 missense possibly damaging 0.77
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0409:Gsap UTSW 5 21222445 splice site probably benign
R0507:Gsap UTSW 5 21269963 missense possibly damaging 0.75
R0624:Gsap UTSW 5 21253951 splice site probably null
R1037:Gsap UTSW 5 21251165 splice site probably benign
R1076:Gsap UTSW 5 21287694 missense possibly damaging 0.75
R1459:Gsap UTSW 5 21207238 splice site probably benign
R1757:Gsap UTSW 5 21281037 missense probably damaging 0.98
R1852:Gsap UTSW 5 21290545 unclassified probably null
R2034:Gsap UTSW 5 21270595 missense probably damaging 1.00
R2069:Gsap UTSW 5 21226839 splice site probably benign
R2125:Gsap UTSW 5 21242813 missense probably damaging 1.00
R2172:Gsap UTSW 5 21222440 critical splice donor site probably null
R2310:Gsap UTSW 5 21196090 nonsense probably null
R2337:Gsap UTSW 5 21288630 missense probably damaging 1.00
R3442:Gsap UTSW 5 21278127 missense probably damaging 1.00
R4229:Gsap UTSW 5 21246977 missense probably benign 0.00
R4271:Gsap UTSW 5 21226350 critical splice donor site probably null
R4551:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4553:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4649:Gsap UTSW 5 21226311 missense probably damaging 1.00
R4687:Gsap UTSW 5 21246971 utr 3 prime probably benign
R4799:Gsap UTSW 5 21250943 missense probably benign 0.05
R4857:Gsap UTSW 5 21287799 splice site probably null
R4973:Gsap UTSW 5 21254039 missense probably benign 0.04
R5015:Gsap UTSW 5 21222408 missense probably damaging 1.00
R5031:Gsap UTSW 5 21242826 missense possibly damaging 0.57
R5120:Gsap UTSW 5 21269936 missense probably damaging 0.96
R5451:Gsap UTSW 5 21217447 missense probably damaging 1.00
R5469:Gsap UTSW 5 21290544 missense possibly damaging 0.92
R5519:Gsap UTSW 5 21289859 missense probably damaging 1.00
R5588:Gsap UTSW 5 21251149 missense probably damaging 1.00
R5650:Gsap UTSW 5 21251053 missense probably damaging 0.99
R6064:Gsap UTSW 5 21229225 missense possibly damaging 0.56
R6139:Gsap UTSW 5 21281540 missense probably damaging 1.00
R6148:Gsap UTSW 5 21226325 missense probably damaging 1.00
R6148:Gsap UTSW 5 21270577 missense probably benign 0.39
R6226:Gsap UTSW 5 21217431 missense probably damaging 1.00
R6859:Gsap UTSW 5 21281018 missense probably damaging 0.99
R6977:Gsap UTSW 5 21271221 missense probably damaging 1.00
R6995:Gsap UTSW 5 21271237 missense possibly damaging 0.58
R7013:Gsap UTSW 5 21278110 missense probably benign 0.39
R7159:Gsap UTSW 5 21270620 splice site probably null
R7181:Gsap UTSW 5 21253429 missense probably damaging 1.00
R7332:Gsap UTSW 5 21290121 missense probably benign 0.00
R7381:Gsap UTSW 5 21226787 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGACTAAAGAAAACCTGCCC -3'
(R):5'- TTGTCCTGATCCTAGCTGAGC -3'

Sequencing Primer
(F):5'- TCCAGTCTGGAAGCTGCTG -3'
(R):5'- ATCCTAGCTGAGCCCAGGAG -3'
Posted On2019-06-26