Incidental Mutation 'R7234:Atxn2l'
ID562703
Institutional Source Beutler Lab
Gene Symbol Atxn2l
Ensembl Gene ENSMUSG00000032637
Gene Nameataxin 2-like
SynonymsA2lp, A2D, A2RP, A2LG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126491708-126503437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126493201 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 958 (L958P)
Ref Sequence ENSEMBL: ENSMUSP00000035415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000098048] [ENSMUST00000106392] [ENSMUST00000166682] [ENSMUST00000167759] [ENSMUST00000206055] [ENSMUST00000206265] [ENSMUST00000206572] [ENSMUST00000206577]
Predicted Effect probably damaging
Transcript: ENSMUST00000040202
AA Change: L958P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637
AA Change: L958P

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Pfam:SM-ATX 119 189 8.5e-21 PFAM
LsmAD 262 331 1.95e-28 SMART
low complexity region 357 382 N/A INTRINSIC
low complexity region 450 470 N/A INTRINSIC
Pfam:PAM2 657 672 5.6e-8 PFAM
low complexity region 681 697 N/A INTRINSIC
low complexity region 764 787 N/A INTRINSIC
low complexity region 920 947 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098048
SMART Domains Protein: ENSMUSP00000095656
Gene: ENSMUSG00000073838

DomainStartEndE-ValueType
Pfam:GTP_EFTU 55 249 2e-55 PFAM
Pfam:GTP_EFTU_D2 272 341 1.3e-15 PFAM
Pfam:GTP_EFTU_D3 345 440 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106392
SMART Domains Protein: ENSMUSP00000102000
Gene: ENSMUSG00000073838

DomainStartEndE-ValueType
Pfam:GTP_EFTU 55 249 2.7e-57 PFAM
Pfam:GTP_EFTU_D2 272 341 2.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166682
AA Change: L838P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125881
Gene: ENSMUSG00000032637
AA Change: L838P

DomainStartEndE-ValueType
Pfam:SM-ATX 1 69 1.6e-21 PFAM
LsmAD 142 211 1.95e-28 SMART
low complexity region 237 262 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
Pfam:PAM2 537 553 4.3e-8 PFAM
low complexity region 561 577 N/A INTRINSIC
low complexity region 644 667 N/A INTRINSIC
low complexity region 800 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167759
AA Change: L872P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637
AA Change: L872P

DomainStartEndE-ValueType
Pfam:SM-ATX 33 103 8.1e-23 PFAM
LsmAD 176 245 1.95e-28 SMART
low complexity region 271 296 N/A INTRINSIC
low complexity region 364 384 N/A INTRINSIC
Pfam:PAM2 571 587 4.2e-8 PFAM
low complexity region 595 611 N/A INTRINSIC
low complexity region 678 701 N/A INTRINSIC
low complexity region 834 861 N/A INTRINSIC
low complexity region 893 905 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
low complexity region 944 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206055
Predicted Effect probably damaging
Transcript: ENSMUST00000206265
AA Change: L59P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000206572
Predicted Effect probably damaging
Transcript: ENSMUST00000206577
AA Change: L952P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Atxn2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Atxn2l APN 7 126498288 missense possibly damaging 0.94
IGL00507:Atxn2l APN 7 126496584 missense possibly damaging 0.51
IGL00846:Atxn2l APN 7 126499178 missense probably damaging 1.00
IGL01813:Atxn2l APN 7 126500253 missense probably damaging 1.00
PIT4378001:Atxn2l UTSW 7 126497271 missense probably benign 0.11
R0005:Atxn2l UTSW 7 126498274 missense probably damaging 1.00
R0267:Atxn2l UTSW 7 126493207 missense probably damaging 1.00
R0608:Atxn2l UTSW 7 126501416 splice site probably null
R0749:Atxn2l UTSW 7 126500837 missense possibly damaging 0.50
R0831:Atxn2l UTSW 7 126499160 missense probably damaging 1.00
R0881:Atxn2l UTSW 7 126496596 missense probably damaging 1.00
R1022:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1024:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1081:Atxn2l UTSW 7 126494212 missense probably damaging 1.00
R1132:Atxn2l UTSW 7 126494248 small deletion probably benign
R1489:Atxn2l UTSW 7 126496467 missense probably damaging 1.00
R1919:Atxn2l UTSW 7 126493168 missense probably damaging 0.99
R2062:Atxn2l UTSW 7 126495866 missense probably damaging 1.00
R2170:Atxn2l UTSW 7 126503239 start gained probably benign
R3719:Atxn2l UTSW 7 126498130 missense probably damaging 1.00
R3861:Atxn2l UTSW 7 126501951 critical splice donor site probably null
R5061:Atxn2l UTSW 7 126500203 missense probably damaging 1.00
R6022:Atxn2l UTSW 7 126496435 critical splice donor site probably null
R6075:Atxn2l UTSW 7 126492517 missense possibly damaging 0.70
R6131:Atxn2l UTSW 7 126503165 unclassified probably benign
R6460:Atxn2l UTSW 7 126494248 small deletion probably benign
R6552:Atxn2l UTSW 7 126493821 missense possibly damaging 0.70
R7167:Atxn2l UTSW 7 126499222 missense possibly damaging 0.76
R7301:Atxn2l UTSW 7 126494211 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTCCAGTTTGGACATGGG -3'
(R):5'- ACTTCTACTCTGGCAGCACC -3'

Sequencing Primer
(F):5'- GAAGAGAATTAGTTTCAGTGCCCCC -3'
(R):5'- CACAGCAGAATCTGTACC -3'
Posted On2019-06-26