Incidental Mutation 'R7234:Tpo'
ID562712
Institutional Source Beutler Lab
Gene Symbol Tpo
Ensembl Gene ENSMUSG00000020673
Gene Namethyroid peroxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location30054659-30132624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30092686 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 680 (P680S)
Ref Sequence ENSEMBL: ENSMUSP00000021005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021005]
Predicted Effect probably benign
Transcript: ENSMUST00000021005
AA Change: P680S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021005
Gene: ENSMUSG00000020673
AA Change: P680S

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:An_peroxidase 145 697 4.2e-180 PFAM
CCP 730 782 1.26e-7 SMART
EGF_CA 784 827 3.51e-10 SMART
transmembrane domain 837 859 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein. The encoded enzyme plays a central role in thyroid gland function. The enzyme functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mice with homozygous missense mutations in this gene exhibit hypothyroid dwarfism and hearing impairment. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mice with a missense mutation exhibit hypothyroid dwarfism, including a goiter with colloid deficiency and abnormal follicle epithelium, reduced hematocrit and red blood cells and a lifespan of about 3 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Tpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tpo APN 12 30084620 missense probably damaging 1.00
IGL00694:Tpo APN 12 30105994 missense probably damaging 0.98
IGL01660:Tpo APN 12 30119400 splice site probably benign
IGL01939:Tpo APN 12 30084647 missense possibly damaging 0.83
IGL02624:Tpo APN 12 30100414 missense probably benign 0.40
IGL03268:Tpo APN 12 30094965 missense possibly damaging 0.82
IGL03330:Tpo APN 12 30103501 missense probably damaging 0.97
IGL03138:Tpo UTSW 12 30074171 missense probably benign 0.00
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0025:Tpo UTSW 12 30100390 missense probably benign 0.03
R0076:Tpo UTSW 12 30104023 missense probably damaging 1.00
R0472:Tpo UTSW 12 30100486 missense probably benign 0.03
R1389:Tpo UTSW 12 30103110 missense probably damaging 0.98
R1493:Tpo UTSW 12 30131809 missense possibly damaging 0.78
R1526:Tpo UTSW 12 30084695 missense probably damaging 0.99
R1674:Tpo UTSW 12 30100568 missense probably benign 0.16
R1689:Tpo UTSW 12 30098246 missense probably damaging 1.00
R1986:Tpo UTSW 12 30119466 missense probably damaging 1.00
R2381:Tpo UTSW 12 30131827 missense possibly damaging 0.67
R2484:Tpo UTSW 12 30103969 missense probably benign 0.12
R2902:Tpo UTSW 12 30119449 missense possibly damaging 0.91
R4105:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4106:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4107:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4108:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4109:Tpo UTSW 12 30092586 missense probably damaging 0.98
R4374:Tpo UTSW 12 30103152 missense possibly damaging 0.50
R4425:Tpo UTSW 12 30104016 missense probably damaging 1.00
R4600:Tpo UTSW 12 30098229 missense probably benign 0.32
R4668:Tpo UTSW 12 30103290 missense probably benign 0.03
R4758:Tpo UTSW 12 30075871 missense probably damaging 1.00
R4838:Tpo UTSW 12 30092634 missense probably damaging 1.00
R4869:Tpo UTSW 12 30103365 missense probably benign 0.00
R5163:Tpo UTSW 12 30105980 missense probably benign 0.00
R5223:Tpo UTSW 12 30092590 missense probably damaging 0.99
R5367:Tpo UTSW 12 30103290 missense probably damaging 1.00
R5658:Tpo UTSW 12 30055138 missense possibly damaging 0.95
R5660:Tpo UTSW 12 30100496 missense possibly damaging 0.92
R5671:Tpo UTSW 12 30119491 missense probably benign 0.00
R6019:Tpo UTSW 12 30094981 missense possibly damaging 0.94
R6074:Tpo UTSW 12 30078187 missense probably benign 0.15
R6181:Tpo UTSW 12 30131885 missense probably benign 0.37
R6321:Tpo UTSW 12 30103108 missense probably damaging 1.00
R6433:Tpo UTSW 12 30084754 missense probably benign
R7206:Tpo UTSW 12 30103134 missense possibly damaging 0.76
X0050:Tpo UTSW 12 30078094 missense probably damaging 1.00
Z1088:Tpo UTSW 12 30094782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTCTCTTTGAGAGGTTAAACTG -3'
(R):5'- AGATTCTCACAAGCCCTGCG -3'

Sequencing Primer
(F):5'- GGTTAAACTGACGTTAATGACACG -3'
(R):5'- GTGCTGTGGCTACCCTATGACAG -3'
Posted On2019-06-26