Incidental Mutation 'R7234:Kcnrg'
ID562721
Institutional Source Beutler Lab
Gene Symbol Kcnrg
Ensembl Gene ENSMUSG00000046168
Gene Namepotassium channel regulator
SynonymsE030012H22Rik, LOC328424
MMRRC Submission
Accession Numbers

Genbank: NM_001039105, NM_206974; MGI: 2685591

Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location61607457-61612826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61608082 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 190 (E190D)
Ref Sequence ENSEMBL: ENSMUSP00000153429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]
Predicted Effect probably benign
Transcript: ENSMUST00000039562
SMART Domains Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051184
SMART Domains Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168

DomainStartEndE-ValueType
BTB 5 106 8.7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165015
SMART Domains Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000225582
AA Change: E190D
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Kcnrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnrg APN 14 61607910 missense probably damaging 1.00
IGL01311:Kcnrg APN 14 61611825 missense probably damaging 1.00
D4216:Kcnrg UTSW 14 61611793 nonsense probably null
R1081:Kcnrg UTSW 14 61607714 missense possibly damaging 0.87
R1346:Kcnrg UTSW 14 61611695 missense probably benign 0.31
R3147:Kcnrg UTSW 14 61607691 missense probably damaging 1.00
R4690:Kcnrg UTSW 14 61611727 missense probably damaging 1.00
R4820:Kcnrg UTSW 14 61607937 missense probably benign 0.39
R5068:Kcnrg UTSW 14 61607817 missense probably damaging 1.00
R5914:Kcnrg UTSW 14 61611831 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTTGCAGCAAAACAATCGAG -3'
(R):5'- TCTAGTTTCCCTGGGCAGTG -3'

Sequencing Primer
(F):5'- TCGAGATGCTAAGTGGGAGGATTAC -3'
(R):5'- GGTTTATTACCTGTTCAACAGTACC -3'
Posted On2019-06-26