Incidental Mutation 'R0577:Mtmr6'
ID56273
Institutional Source Beutler Lab
Gene Symbol Mtmr6
Ensembl Gene ENSMUSG00000021987
Gene Namemyotubularin related protein 6
Synonyms4022440C11Rik
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0577 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location60265228-60302370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60296638 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 442 (V442I)
Ref Sequence ENSEMBL: ENSMUSP00000153403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022563] [ENSMUST00000224366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022563
AA Change: V404I

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022563
Gene: ENSMUSG00000021987
AA Change: V404I

DomainStartEndE-ValueType
Pfam:Myotub-related 107 446 1.3e-143 PFAM
coiled coil region 510 548 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224164
Predicted Effect possibly damaging
Transcript: ENSMUST00000224366
AA Change: V442I

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Mtmr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Mtmr6 APN 14 60280217 nonsense probably null
IGL01377:Mtmr6 APN 14 60282034 nonsense probably null
IGL02579:Mtmr6 APN 14 60281929 splice site probably benign
IGL02598:Mtmr6 APN 14 60300504 missense probably damaging 1.00
IGL03007:Mtmr6 APN 14 60289535 splice site probably benign
Chilly UTSW 14 60292129 splice site probably null
IGL03046:Mtmr6 UTSW 14 60292128 critical splice donor site probably null
R0542:Mtmr6 UTSW 14 60292129 splice site probably null
R1845:Mtmr6 UTSW 14 60296735 missense probably damaging 1.00
R1999:Mtmr6 UTSW 14 60293407 missense probably damaging 1.00
R2018:Mtmr6 UTSW 14 60298992 missense probably benign
R2019:Mtmr6 UTSW 14 60298992 missense probably benign
R2078:Mtmr6 UTSW 14 60291987 splice site probably null
R2120:Mtmr6 UTSW 14 60296659 missense probably damaging 1.00
R3743:Mtmr6 UTSW 14 60300298 missense probably benign 0.02
R4739:Mtmr6 UTSW 14 60292097 missense probably damaging 1.00
R4946:Mtmr6 UTSW 14 60280189 missense possibly damaging 0.95
R5603:Mtmr6 UTSW 14 60285001 nonsense probably null
R6056:Mtmr6 UTSW 14 60298170 missense probably damaging 1.00
R6489:Mtmr6 UTSW 14 60300514 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGTGGCATGGGAACTATAGCTCTG -3'
(R):5'- GTACAGCCATGATGTACGGTGGTG -3'

Sequencing Primer
(F):5'- gtcctcctgcttttccttcc -3'
(R):5'- ATGTACGGTGGTGCAGGG -3'
Posted On2013-07-11